Previous Contig 005474:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002O03Sequence480005474 (26)gb:AY326307_15996582e-11Cucurbita maxima gibberellic acid insensitive phloem B (GAIP-B) mRNA, complete c722010531 (22)gb:AF378125_17933445e-74Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMFF007O08Sequence463005474 (26)gb:AF378125_17933446e-06Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.722010531 (22)gb:AF378125_17933445e-74Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMFF013J02Sequence537005474 (26)gb:AF378125_17933442e-13Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.692010531 (22)gb:AF378125_17933442e-69Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMFF036N08Sequence466005474 (26)gb:AY326307_15996582e-12Cucurbita maxima gibberellic acid insensitive phloem B (GAIP-B) mRNA, complete c650010531 (22)gb:AF378125_17933442e-66Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMFF038L12Sequence442005474 (26)gb:AY269087_15940270.008Lycopersicon esculentum GAI-like protein mRNA, complete cds.740010531 (22)gb:AF378125_17933442e-78Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMFF045G18Sequence638005474 (26)gb:AF378125_17933443e-22Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.626010531 (22)gb:AF378125_17933443e-43Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMFF050L17Sequence621005474 (26)gb:AF378125_17933446e-22Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.589010531 (22)gb:AY269087_15940273e-43Lycopersicon esculentum GAI-like protein mRNA, complete cds.
JMFS056A07Sequence627005474 (26)gb:AF378125_17933443e-26Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMFS068D02Sequence606005474 (26)gb:AF378125_17933446e-32Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMFS075E08Sequence617005474 (26)gb:AF378125_17933443e-26Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMFS109B02Sequence610005474 (26)gb:AF378125_17933443e-26Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF003F19Sequence391005474 (26)732010531 (22)gb:AF378125_17933441e-78Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF003F20Sequence345005474 (26)733010531 (22)gb:AF378125_17933441e-78Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF005M03Sequence339005474 (26)406011500 (6)gb:GMU51194_16806887e-24Glycine max peroxidase (sEPb2) mRNA, partial cds.
JMSF006D23Sequence353005474 (26)186011247 (2)
JMSF006N13Sequence345005474 (26)299005125 (29)gb:ALFHISH3A_18189773e-16Alfalfa histone H3 (H3-1.1) gene, complete cds.
JMSF010I22Sequence255005474 (26)648007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi
JMSF014G22Sequence350005474 (26)742010531 (22)gb:AF378125_17933441e-80Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF014P05Sequence468005474 (26)gb:AY269087_15940271e-08Lycopersicon esculentum GAI-like protein mRNA, complete cds.751010531 (22)gb:AF378125_17933446e-73Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF014P15Sequence440005474 (26)gb:AY269087_15940270.024Lycopersicon esculentum GAI-like protein mRNA, complete cds.766010531 (22)gb:AF378125_17933441e-79Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF019K02Sequence475005474 (26)gb:AY269087_15940275e-07Lycopersicon esculentum GAI-like protein mRNA, complete cds.622007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi
JMSF023C14Sequence608005474 (26)gb:AF378125_17933444e-25Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.756010531 (22)gb:AF378125_17933446e-79Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF024O22Sequence596005474 (26)gb:AF378125_17933442e-24Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.736010531 (22)gb:AF378125_17933445e-81Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF030K18Sequence354005474 (26)665010531 (22)gb:AF378125_17933445e-73Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF049G08Sequence697005474 (26)gb:AF378125_17933442e-32Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.759010531 (22)gb:AF378125_17933445e-73Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.
JMSF051C10Sequence672005474 (26)gb:AF378125_17933442e-25Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.735010531 (22)gb:AF378125_17933443e-82Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049G08+ TCAACCAGGACTACTGAGCGAGTTGACTCAGAAGGAGAGATTGACTCGC
                      ____________________________________________________________
consensus TCAACCAGGACTACTGAGCGAGTTGACTCAGAAGGAGAGATTGACTCGC
 
. : . : . : . : . : . :
JMSF049G08+ CGCCGTTAGGACTTCCCCATACGCCGCCGTTTCCGCCGCCGAGCTGCATGTTGGAGGAGG
                      ____________________________________________________________
consensus CGCCGTTAGGACTTCCCCATACGCCGCCGTTTCCGCCGCCGAGCTGCATGTTGGAGGAGG
 
. : . : . : . : . : . :
JMSF049G08+ TGGAGGAAGTGGTGGAAGCCGTCCTGAATCTCTTGCTTGGAGGTTGAGGATACGCGGCTT
JMFS068D02+ AGGTTGAGGATACGCGGCTT
                      ____________________________________________________________
consensus TGGAGGAAGTGGTGGAAGCCGTCCTGAATCTCTTGCTTGGAGGTTGAGGATACGCGGCTT
 
. : . : . : . : . : . :
JMSF049G08+ TGCCTGGAATTGCGGTGAGATCTGAATCGAAAGAGGAGTCGTCGAAGATCTGAGTGGAGT
JMFS068D02+ TGCCTGGAATTGCGGTGAGATCTGAATCGAAAGAGGAGTCGTCGAAGATCTGAGTGGAGT
JMFF045G18+ TGAATCGAAAGAGGAGTCGTCGAAGATCTGAGTGGAGT
JMSF051C10+ TCTGAGTGGAGT
                      ____________________________________________________________
consensus TGCCTGGAATTGCGGTGAGATCTGAATCGAAAGAGGAGTCGTCGAAGATCTGAGTGGAGT
 
. : . : . : . : . : . :
JMSF049G08+ TTCGGGTGATGGCGGAGGAGGATTCGGTTTGGGACGACAAAAACGGGTCGCCCAGGTTGA
JMFS068D02+ TTCGGGTGATGGCGGAGGAGGATTCGGTTTGGGACGACAAAAACGGGTCGCCCAGGTTGA
JMFF045G18+ TTCGGGTGATGGCGGAGGAGGATTCGGTTTGGGACGACAAAAACGGGTCGCCCAGGTTGA
JMFS075E08+ ATTCGGTTTGGGACGACAAAAACGGGTCGCNCAGGTTGA
JMFS109B02+ CGACAAAAACGGGTCGCNCAGGTTGA
JMFS056A07+ GAGGATTCGGTTTGGGACGACAAAAACGGGTCGCNCAGGTTGA
JMFF050L17+ ACGACAAAAACGGGTCGCCCAGGTTGA
JMSF051C10+ TTCGGGTGATGGCGGAGGAGGATTCGGTTTGGGACGACAAAAACGGGTCGCCCAGGTTGA
JMSF023C14+ CAGGTTGA
                      ____________________________________________________________
consensus TTCGGGTGATGGCGGAGGAGGATTCGGTTTGGGACGACAAAAACGGGTCGCCCAGGTTGA
 
. : . : . : . : . : . :
JMSF049G08+ GCTCGGAAATCATGGAGTCCACCCAGGAGGAGAGATCCGACGGGTTGTAATGAACCGTCT
JMFS068D02+ GCTCGGAAATCATGGAGTCCACCCAGGAGGAGAGATCCGACGGGTTGTAATGAACCGTCT
JMFF045G18+ GCTCGGAAATCATGGAGTCCACCCAGGAGGAGAGATCCGACGGGTTGTAATGAACCGTCT
JMFS075E08+ GCTCGGAAATCATGGAGTCCACCCAGGAGGAGAGATCCGACGGGTTGTAATGAACCGTCT
JMFS109B02+ GCTCGGAAATCATGGAGTCCACCCAGGAGGAGAGATCCGACGGGTTGTAATGAACCGTCT
JMFS056A07+ GCTCGGAAATCATGGAGTCCACCCAGGAGGAGAGATCCGACGGGTTGTAATGAACCGTCT
JMFF050L17+ GCTCGGAAATCATGGAGTCCACCCAGGAGGAGAGAT-CGACGGGTTGTAATGAACCGTCT
JMSF024O22+ TCGGAAATCATGGAGTCCACCCANGAGGAGAGATCCGACGGGTTGTAATGAACCGTCT
JMSF051C10+ GCTCGGAAATCATGGAGTCCACCCAGGAGGAGAGATCCGACGGGTTGTAATGAACCGTCT
JMSF023C14+ GCTCGGAAATCATGGAGTCCACCCAGGAGGAGAGATCCGACGGGTTGTAATGAACCGTCT
                      ____________________________________________________________
consensus GCTCGGAAATCATGGAGTCCACCCAGGAGGAGAGATCCGACGGGTTGTAATGAACCGTCT
 
. : . : . : . : . : . :
JMSF049G08+ CCGACGCCAAGCTCGACAGGTCGTCTCCCTGAACGCTCCCCATCACTTCCTCTAACTGCT
JMFS068D02+ CCGACGCCAAGCTCGACAGGTCGTCTCCCTGAACGCTCCCCATCACTTCCTCTAACTGCT
JMFF045G18+ CCGACGCCAAGCTCGACAGGTCGTCTCCCTGAA-GCTCCCCATCACTTCCTCTAACTGCT
JMFS075E08+ CCGACGCCAAGCTCGACAGGTCGTCTCCCTGAACGCTCCCCATCACTTCCTCTAACTGCT
JMFS109B02+ CCGACGCCAAGCTCGACAGGTCGTCTCCCTGAACGCTCCCCATCACTTCCTCTAACTGCT
JMFS056A07+ CCGACGCCAAGCTCGACAGGTCGTCTCCCTGAACGCTCCCCATCACTTCCTCTAACTGCT
JMFF050L17+ CCGACGCCAAGCTCGACAGGTCGTCTCCCTGAACGCTCCCCATCACTTCCTCTAACTGCT
JMSF024O22+ CCGACGCCAAGCTCGACAGGTCGTCTCCCTGAACGCTCCCCATCACTTCCTCTAACTGCT
JMSF014P05+ TGCT
JMFF036N08+ CCCTGAACGCTCCCCATCACTTCCTCTAACTGCT
JMFF013J02+ GACGCCAAGCTCGACAGGTCGTCTCCCTGAACGCTCCCCATCACTTCCTCTAACTGCT
JMFF002O03+ CCGACGCCAAGCTCGACAGGTCGTCTCCCTGAA-GCTCCCCATCACTTCCTCTAACTGCT
JMSF051C10+ CTGACGCCAAGCTCGACAGGTCGTCTCCCTGAACGCTCCCCATCACTTCCTCTAACTGCT
JMSF023C14+ CNGACGCCAAGCTCGACAGGTCGTCTCCCTGAACGCTCCCCATCACTTCCTCTAACTGCT
                      ____________________________________________________________
consensus CCGACGCCAAGCTCGACAGGTCGTCTCCCTGAACGCTCCCCATCACTTCCTCTAACTGCT
 
. : . : . : . : . : . :
JMSF049G08+ CAAGCTTCTGAGCCACCTCCGCCATGTCCGACGCCTTCACCTTATACCCTAAAACCGCCA
JMFS068D02+ CAAGCTTCTGAGCCACCTCCGCCATGTCCGACGCCTTCACCTTATACCCTAAAACCGCCA
JMFF045G18+ CAAGCTTCTGAGCCACCTCCGCCATGTCCGACGCCTTCACCTTATACCCTAAAACCGCCA
JMFS075E08+ CAAGCTTCTGAGCCACCTCCGCCATGTCCGACGCCTTCACCTTATACCCTAAAACCGCCA
JMFS109B02+ CAAGCTTCTGAGCCACCTCCGCCATGTCCGACGCCTTCACCTTATACCCTAAAACCGCCA
JMFS056A07+ CAAGCTTCTGAGCCACCTCCGCCATGTCCGACGCCTTCACCTTATACCCTAAAACCGCCA
JMFF050L17+ CAAGCTTCTGAGCCACCTCCGCCATGTCCGACGCCTTCACCTTATACCCTAAAACCGCCA
JMSF024O22+ CAAGCTTCTGAGCCACCTCCGCCATGTCCGACGCCTTCACCTTATACCCTAAAACCGCCA
JMSF014P05+ CAAGCTTTTGAGCCACNTCCGCCATGTCCGACGCCTTCACCTTATACCCTAAAACCGCCA
JMFF036N08+ CAAGCTTTTGAGCCACCTCCGCCATGTCCGACGCCTTCACCTTATACCCTAAAACCGCCA
JMSF003F19+ ACCCTAAAACCGCCA
JMFF013J02+ CAAGCTTNTGAGCCACCTCCGCCATGTCCGACGCCTTCACCTTATACCCTAAAACCGCCA
JMFF002O03+ CAAGCTTNTGAGCCACCTCCGCCATGTCCGACGCCTTCACCTTATACCCTAAAACCGCCA
JMSF019K02+ TGAGCCACNTCCGCCATGTCNGACGCCTTCACCTTATACCCTAAAACCGCCA
JMFF007O08+ CTCCGCCATGTCCGACGCCTTCACCTTATACCCTAAAACCGCCA
JMFF038L12+ CACCTTATACCCTAAAACCGCCA
JMSF051C10+ CAAGCTTNTGAGCCACCTCCGCCATGTCCGACGCCTTCACCTTATACCCTAAAACCGCCA
JMSF023C14+ CAAGCTTNTGAGCCACCTCCGCCATGTCCGACGCCTTCACCTTATACCCTAAAACCGCCA
JMSF014P15+ CTTATACCCTAAAACCGCCA
                      ____________________________________________________________
consensus CAAGCTTCTGAGCCACCTCCGCCATGTCCGACGCCTTCACCTTATACCCTAAAACCGCCA
 
. : . : . : . : . : . :
JMSF049G08+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
JMFS068D02+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
JMFF045G18+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
JMFS075E08+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
JMFS109B02+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
JMFS056A07+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
JMFF050L17+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
JMSF024O22+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
JMSF014P05+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
JMFF036N08+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTNTTCCCCTTCGACA
JMSF003F19+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
JMSF006D23+ TCGACA
JMSF030K18+ GACA
JMSF003F20+ TTCGACA
JMSF006N13+ CTTCGACA
JMFF013J02+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
JMFF002O03+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
JMSF019K02+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
JMFF007O08+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
JMFF038L12+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
JMSF051C10+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
JMSF023C14+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
JMSF014P15+ AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
                      ____________________________________________________________
consensus AAAGCTCATCCATTCCCGCGTCCTGCTCACTCTCCTCCCACATCTTCTTCCCCTTCGACA
 
. : . : . : . : . : . :
JMSF049G08+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMFS068D02+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMFF045G18+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMFS075E08+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMFS109B02+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMFS056A07+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMFF050L17+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMSF024O22+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMSF014P05+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMFF036N08+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMSF003F19+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMSF006D23+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMSF030K18+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMSF003F20+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMSF005M03+ ACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMSF006N13+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMFF013J02+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMFF002O03+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMSF019K02+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMFF007O08+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMFF038L12+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMSF051C10+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMSF023C14+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMSF014P15+ ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
JMSF014G22+ ACTCCCACCACCGCTTCTCTNGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
                      ____________________________________________________________
consensus ACCCGCTGCTACTCCCACCACCGCTTCTCTCGCCGCCGCTCCCGGCGCCGGAAAAGGAAC
 
. : . : . : . : . : . :
JMSF049G08+ CCCGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMFS068D02+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMFF045G18+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMFS075E08+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMFS109B02+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMFS056A07+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMFF050L17+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMSF024O22+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMSF014P05+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMFF036N08+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMSF003F19+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMSF006D23+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMSF030K18+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMSF003F20+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMSF005M03+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMSF006N13+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMFF013J02+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMFF002O03+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMSF019K02+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMFF007O08+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMFF038L12+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTNTCAGAAAAAGGA
JMSF010I22+ TTCAGAAAAAGGA
JMSF051C10+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMSF023C14+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMSF014P15+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
JMSF014G22+ CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
                      ____________________________________________________________
consensus CCTGAACACTACGATTGAAATGGTCTCTTTTCATTTTTTTTGGGAGTTTCAGAAAAAGGA
 
. : . : . : . : . : . :
JMSF049G08+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTT
JMFS068D02+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMFF045G18+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMFS075E08+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMFS109B02+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATTTTTTCACCGA
JMFS056A07+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMFF050L17+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMSF024O22+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMSF014P05+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMFF036N08+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMSF003F19+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMSF006D23+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMSF030K18+ AGATGAGAGATTAGTTTTNTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMSF003F20+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMSF005M03+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMSF006N13+ AGA-GAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMFF013J02+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMFF002O03+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMSF019K02+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMFF007O08+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCNCCGA
JMFF038L12+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMSF010I22+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMSF051C10+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMSF023C14+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMSF014P15+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
JMSF014G22+ AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
                      ____________________________________________________________
consensus AGATGAGAGATTAGTTTTCTTCACTGCTTCTTTGAAAATCTCTTGTTATCTTTTCACCGA
 
. : . : . : . : . : . :
JMFS068D02+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGA
JMFF045G18+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMFS075E08+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMFS109B02+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMFS056A07+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMFF050L17+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMSF024O22+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMSF014P05+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMFF036N08+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMSF003F19+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMSF006D23+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMSF030K18+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMSF003F20+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMSF005M03+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMSF006N13+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMFF013J02+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMFF002O03+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMSF019K02+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMFF007O08+ GAGAGATGGAGTTTATGCATATTAAAGTTACTNCATGCTATTCCGATTGGGCNCTACGAA
JMFF038L12+ GAGAGATGGAGTTTATNCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTNNGAA
JMSF010I22+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMSF051C10+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMSF023C14+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMSF014P15+ GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
JMSF014G22+ GAGAGANGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
                      ____________________________________________________________
consensus GAGAGATGGAGTTTATGCATATTAAAGTTACTACATGCTATTCCGATTGGGCACTACGAA
 
. : . : . : . : . : . :
JMFF045G18+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMFS075E08+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMFS109B02+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMFS056A07+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMFF050L17+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMSF024O22+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMSF014P05+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMFF036N08+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAG
JMSF003F19+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMSF006D23+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMSF030K18+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMSF003F20+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMSF005M03+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMSF006N13+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMFF013J02+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMFF002O03+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMSF019K02+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMFF007O08+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMFF038L12+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMSF010I22+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMSF051C10+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMSF023C14+ AACAGGCAGTACGGGGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMSF014P15+ AACAGGCAGTACGGGGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
JMSF014G22+ AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
                      ____________________________________________________________
consensus AACAGGCAGTACGGAGAGGGAGAGAGAAAGAGAGAGAGAGAGAGAGGAGAGAGAGAGGGT
 
. : . : . : . : . : . :
JMFF045G18+ C
JMFS075E08+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTA
JMFS109B02+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGCTA
JMFS056A07+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGCTA
JMFF050L17+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGCTACAGAAAGAAC
JMSF024O22+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGCTACAGAAAGAACAGC
JMSF014P05+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGC
JMSF003F19+ CGTGAAGGTGGGCAC
JMSF006D23+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGCTAC
JMSF030K18+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGCTAC
JMSF003F20+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCT
JMSF005M03+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGCTACAGAAAGAAC
JMSF006N13+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTT
JMFF013J02+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGCTACAGAAAGAACAGC
JMFF002O03+ C
JMSF019K02+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGCTACAGAAAGAACAGC
JMFF007O08+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGCTACAGAAAGAACAGCTC
JMFF038L12+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGCTACAGAAAGAACAGCTC
JMSF010I22+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGCTACAGAAAGAACAGC
JMSF051C10+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGCTACAGAAAGAACAGCTCC
JMSF023C14+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGCTACAGAAAGAACAGCTCC
JMSF014P15+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGCTACAGAAAGAACAGCTCC
JMSF014G22+ CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGCTACAGAAAGAACAGCTCC
                      ____________________________________________________________
consensus CGTGAAGGTGGGCACAGGGAACGAAGTTCTGAAGCTTACAGCTACAGAAAGAACAGCTCC