Previous Contig 005472:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014I21Sequence485005472 (13)gb:OSJN00108_16950696e-61Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0070J16, complete seque618005472 (13)gb:OSJN00108_16950691e-60Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0070J16, complete seque
JMFF022P07Sequence533005472 (13)gb:OSJN00108_16950698e-61Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0070J16, complete seque626005472 (13)gb:OSJN00108_16950691e-60Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0070J16, complete seque
JMFF049I18Sequence644005472 (13)gb:OSJN00108_16950691e-60Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0070J16, complete seque555005472 (13)gb:OSJN00108_16950691e-56Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0070J16, complete seque
JMFN004M04Sequence603005472 (13)gb:OSJN00108_16950691e-60Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0070J16, complete seque
JMFN035O06Sequence626005472 (13)gb:OSJN00108_16950691e-60Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0070J16, complete seque
JMFS046D10Sequence559005472 (13)gb:OSJN00108_16950692e-52Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0070J16, complete seque
JMSF008I17Sequence383005472 (13)gb:AB008846_15105583e-49Cucumis sativus Csf-1 mRNA, partial cds.605005472 (13)gb:OSJN00108_16950691e-60Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0070J16, complete seque
JMSF014G14Sequence523005472 (13)gb:OSJN00108_16950698e-61Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0070J16, complete seque582005472 (13)gb:OSJN00108_16950691e-60Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0070J16, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF014I21- AAAACACTTGAGAC
JMFS046D10+ GTCCAAAAACACTTGAGAC
JMFN004M04+ GTCCAAAAACACTTGAGAC
rJMFF022P07- CCAAAATTATGTCCAAAAACACTTGAGAC
                      ____________________________________________________________
consensus CCAAAATTATGTCCAAAAACACTTGAGAC
 
. : . : . : . : . : . :
rJMFF014I21- ATGATAATAGTATGTATGTTCTCTAGCTGCAACAAAACCAGAAGAAAAAATAATCCTTGA
JMFS046D10+ ATGATAATAGTATGTATGTCTTCTAGCTGCAACAAAACCAGAAGAAAAAATAATCCTTGA
JMFN004M04+ ATGATAATAGTATGTATGTTCTCTAGCTGCAACAAAACCAGAAGAAAAAATAATCCTTGA
rJMFF022P07- ATGATAATAGTATGTATGTTCTCTAGCTGCAACAAAACCAGAAGAAAAAATAATCCTTGA
rJMSF008I17- GTTCTCTAGCTGCAACAAAACCAGAAGAAAAAATAATCCTTGA
rJMSF014G14- TGTTCTCTAGCTGCAACAAAACCAGAAGAAAAAATAATCCTTGA
                      ____________________________________________________________
consensus ATGATAATAGTATGTATGTTCTCTAGCTGCAACAAAACCAGAAGAAAAAATAATCCTTGA
 
. : . : . : . : . : . :
JMFF014I21+ TTATAATAAAATCACAGTATCTGAGTACAC
rJMFF014I21- AAGCTAAAAAATACAACACCAAAAACTAGTTTATAATAAAATCACAGTATCTGAGTACAC
JMFS046D10+ AAGCTAAAAAATACAACACCAAAAACTAGTTTATAATAAAATCACAGTATCTGAGTACAC
JMFN004M04+ AAGCTAAAAAATACAACACCAAAAACTAGTTTATAATAAAATCACAGTATCTGAGTACAC
rJMFF022P07- AAGCTAAAAAATACAACACCAAAAACTAGTTTATAATAAAATCACAGTATCTGAGTACAC
rJMSF008I17- AAGCTAAAAAATACAACACCAAAAACTAGTTTATAATAAAATCACAGTATCTGAGTACAC
JMFF022P07+ TAAAAAATACAACACCAAAAACTAGTTTATAATAAAATCACAGTATCTGAGTACAC
rJMSF014G14- AAGCTAAAAAATACAACACCAAAAACTAGTTTATAATAAAATCACAGTATCTGAGTACAC
JMSF014G14+ ACACCAAAAACTAGTTTATAATAAAATCACAGTATCTGAGTACAC
                      ____________________________________________________________
consensus AAGCTAAAAAATACAACACCAAAAACTAGTTTATAATAAAATCACAGTATCTGAGTACAC
 
. : . : . : . : . : . :
rJMFF049I18- AGGCTGTGCTCTCCTTCTTAAGCTTTGAAAGCTCCTGCCTTACAATGC
JMFF014I21+ TATTGTTCTCTCAGGCTGTGCTCTCCTTCTTAAGCTTTGAAAGCTCCTGCCTTACAATGC
rJMFF014I21- TATTGTTCTCTCAGGCTGTGCTCTCCTTCTTAAGCTTTGAAAGCTCCTGCCTTACAATGC
JMFS046D10+ TATTGTTCTTTCAGGCTGTGCTCTCCTTCTTAAGCTTTGAAAGCTCCTGCCTTACAATGC
JMFN004M04+ TATTGTTCTCTCAGGCTGTGCTCTCCTTCTTAAGCTTTGAAAGCTCCTGCCTTACAATGC
JMFF049I18+ AGGCTGTGCTCTCCTTCTTAAGCTTTGAAAGCTCCTGCCTTACAATGC
rJMFF022P07- TATTGTTCTCTCAGGCTGTGCTCTCCTTCTTAAGCTTTGAAAGCTCCTGCCTTACAATGC
rJMSF008I17- TATTGTTCTCTCAGGCTGTGCTCTCCTTCTTAAGCTTTGAAAGCTCCTGCCTTACAATGC
JMFN035O06+ AGGCTGTGCTCTCCTTCTTAAGCTTTGAAAGCTCCTGCCTTACAATGC
JMFF022P07+ TATTGTTCTCTCAGGCTGTGCTCTCCTTCTTAAGCTTTGAAAGCTCCTGCCTTACAATGC
rJMSF014G14- TATTGTTCTCTCAGGCTGTGCTCTCCTTCTTAAGCTTTGAAAGCTCCTGCCTTACAATGC
JMSF014G14+ TATTGTTCTCTCAGGCTGTGCTCTCCTTCTTAAGCTTTGAAAGCTCCTGCCTTACAATGC
                      ____________________________________________________________
consensus TATTGTTCTCTCAGGCTGTGCTCTCCTTCTTAAGCTTTGAAAGCTCCTGCCTTACAATGC
 
. : . : . : . : . : . :
rJMFF049I18- CAGCCTTCTTGATTTTTGCCAACATAATCTTAAACCTGTCAAAATCATTCAGAGAGGCTC
JMFF014I21+ CAGCCTTCTTGATTTTTGCCAACATAATCTTAAACCTGTCAAAATCATTCAGAGAGGCTC
rJMFF014I21- CAGCCTTCTTGATTTTTGCCAACATAATCTTAAACCTGTCAAAATCATTCAGAGAGGCTC
JMFS046D10+ CAGCCTTTTTGATTTTTGCCAACATAATCTTAAACCTGTCAAAATCATTCAGAGAGGCTC
JMFN004M04+ CAGCCTTCTTGATTTTTGCCAACATAATCTTAAACCTGTCAAAATCATTCAGAGAGGCTC
JMFF049I18+ CAGCCTTCTTGATTTTTGCCAACATAATCTTAAACCTGTCAAAATCATTCAGAGAGGCTC
rJMFF022P07- CAGCCTTCTTGATTTTTGCCAACATAATCTTAAACCTGTCAAAATCATTCAGAGAGGCTC
rJMSF008I17- CAGCCTTCTTGATTTTTGCCAACATAATCTTAAACCTGTCAAAATCATTCAGAGAGGCTC
JMFN035O06+ CAGCCTTCTTGATTTTTGCCAACATAATCTTAAACCTGTCAAAATCATTCAGAGAGGCTC
JMFF022P07+ CAGCCTTCTTGATTTTTGCCAACATAATCTTAAACCTGTCAAAATCATTCAGAGAGGCTC
JMSF008I17+ CTGTCAAAATCATTCAGAGAGGCTC
rJMSF014G14- CAGCCTTCTTGATTTTTGCCAACATAATCTTAAACCTGTCAAAATCATTCAGAGAGGCTC
JMSF014G14+ CAGCCTTCTTGATTTTTGCCAACATAATCTTAAACCTGTCAAAATCATTCAGAGAGGCTC
                      ____________________________________________________________
consensus CAGCCTTCTTGATTTTTGCCAACATAATCTTAAACCTGTCAAAATCATTCAGAGAGGCTC
 
. : . : . : . : . : . :
rJMFF049I18- TCCTCTTCTGCACTATCAACTTCCTTCCCCAGGAACTGTTCTCCCATTTATTCTTTACAT
JMFF014I21+ TCCTCTTCTGCACTATCAACTTCCTTCCCCAGGAACTGTTCTCCCATTTATTCTTTACAT
rJMFF014I21- TCCTCTTCTGCACTATCAACTTCCTTCCCCAGGAACTGTTCTCCCATTTATTCTTTACAT
JMFS046D10+ TCCTCTTCTGCACTANCAACTTCCTTCCCCAGGAACTGTTNNCCCATTTATTCTTTACAT
JMFN004M04+ TCCTCTTCTGCACTATCAACTTCCTTCCCCAGGAACTGTTCTCCCATTTATTCTTTACAT
JMFF049I18+ TCCTCTTCTGCACTATCAACTTCCTTCCCCAGGAACTGTTCTCCCATTTATTCTTTACAT
rJMFF022P07- TCCTCTTCTGCACTATCAACTTCCTTCCCCAGGAACTGTTCTCCCATTTATTCTTTACAT
rJMSF008I17- TCCTCTTCTGCACTATCAACTTCCTTCCCCAGGAACTGTTCTCCCATTTATTCTTTACAT
JMFN035O06+ TCCTCTTCTGCACTATCAACTTCCTTCCCCAGGAACTGTTCTCCCATTTATTCTTTACAT
JMFF022P07+ TCCTCTTCTGCACTATCAACTTCCTTCCCCAGGAACTGTTCTCCCATTTATTCTTTACAT
JMSF008I17+ TCCTCTTCTGCACTATCAACTTCCTTCCCCAGGAACTGTTCTCCCATTTATTCTTTACAT
rJMSF014G14- TCCTCTTCTGCACTATCAACTTCCTTCCCCAGGAACTGTTCTCCCATTTATTCTTTACAT
JMSF014G14+ TCCTCTTCTGCACTATCAACTTCCTTCCCCAGGAACTGTTCTCCCATTTATTCTTTACAT
                      ____________________________________________________________
consensus TCCTCTTCTGCACTATCAACTTCCTTCCCCAGGAACTGTTCTCCCATTTATTCTTTACAT
 
. : . : . : . : . : . :
rJMFF049I18- CAGCTGCTTCCATTGCTGC--AATCAAAGTCTTCTTCTTGGGAACCCTTTTGATGTCAAT
JMFF014I21+ CAGCTGCTTCCATTGCTGC--AATCAAAGTCTTCTTCTTGGGAACCCTTTTGATGTCAAT
rJMFF014I21- CAGCTGCTTCCATTGCTGC--AATCAAAGTCTTCTTCTTGGGAACCCTTTTGATGTCAAT
JMFS046D10+ CTGCTGCTTCCATTGTTGCTATATCAAAGTCTTCTTCTTGGGAACCCTTTTGATGTCAAT
JMFN004M04+ CAGCTGCTTCCATTGCTGC--AATCAAAGTCTTCTTCTTGGGAACCCTTTTGATGTCAAT
JMFF049I18+ CAGCTGCTTCCATTGCTGC--AATCAAAGTCTTCTTCTTGGGAACCCTTTTGATGTCAAT
rJMFF022P07- CAGCTGCTTCCATTGCTGC--AATCAAAGTCTTCTTCTTGGGAACCCTTTTGATGTCAAT
rJMSF008I17- CAGCTGCTTCCATTGCTGC--AATCAAAGTCTTCTTCTTGGGAACCCTTTTGATGTCAAT
JMFN035O06+ CAGCTGCTTCCATTGCTGC--AATCAAAGTCTTCTTCTTGGGAACCCTTTTGATGTCAAT
JMFF022P07+ CAGCTGCTTCCATTGCTGC--AATCAAAGTCTTCTTCTTGGGAACCCTTTTGATGTCAAT
JMSF008I17+ CAGCTGCTTCCATTGCTGC--AATCAAAGTCTTCTTCTTGGGAACCCTTTTGATGTCAAT
rJMSF014G14- CAGCTGCTTCCATTGCTGC--AATCAAAGTCTTCTTCTTGGGAACCCTTTTGATGTCAAT
JMSF014G14+ CAGCTGCTTCCATTGCTGC--AATCAAAGTCTTCTTCTTGGGAACCCTTTTGATGTCAAT
                      ____________________________________________________________
consensus CAGCTGCTTCCATTGCTGC--AATCAAAGTCTTCTTCTTGGGAACCCTTTTGATGTCAAT
 
. : . : . : . : . : . :
rJMFF049I18- GGTTATGTCAGTGAGTGTAAGTCTCTTGAAGTTCATTTGGCTCCTCACCATGTCAGGAGC
JMFF014I21+ GGTTATGTCAGTGAGTGTAAGTCTCTTGAAGTTCATTTGGCTCCTCACCATGTCAGGAGC
rJMFF014I21- GGTTATGTCAGTGAGTGTAAGTCTCTTGAAGTTCATTTGGCTCCTCACCATGTCAGGAGC
JMFS046D10+ GGTTATGTCAGTGAGTGTAAGTCTCTTGAAGTTCATTTGGCTCCTCACCATGTCAGGAGC
JMFN004M04+ GGTTATGTCAGTGAGTGTAAGTCTCTTGAAGTTCATTTGGCTCCTCACCATGTCAGGAGC
JMFF049I18+ GGTTATGTCAGTGAGTGTAAGTCTCTTGAAGTTCATTTGGCTCCTCACCATGTCAGGAGC
rJMFF022P07- GGTTATGTCAGTGAGTGTAAGTCTCTTGAAGTTCATTTGGCTCCTCACCATGTCAGGAGC
rJMSF008I17- GGTTATGTCAGTGAGTGTAAGTCTCTTGAAGTTCATTTGGCTCCTCACCATGTCAGGAGC
JMFN035O06+ GGTTATGTCAGTGAGTGTAAGTCTCTTGAAGTTCATTTGGCTCCTCACCATGTCAGGAGC
JMFF022P07+ GGTTATGTCAGTGAGTGTAAGTCTCTTGAAGTTCATTTGGCTCCTCACCATGTCAGGAGC
JMSF008I17+ GGTTATGTCAGTGAGTGTAAGTCTCTTGAAGTTCATTTGGCTCCTCACCATGTCAGGAGC
rJMSF014G14- GGTTATGTCAGTGAGTGTAAGTCTCTTGAAGTTCATTTGGCTCCTCACCATGTCAGGAGC
JMSF014G14+ GGTTATGTCAGTGAGTGTAAGTCTCTTGAAGTTCATTTGGCTCCTCACCATGTCAGGAGC
                      ____________________________________________________________
consensus GGTTATGTCAGTGAGTGTAAGTCTCTTGAAGTTCATTTGGCTCCTCACCATGTCAGGAGC
 
. : . : . : . : . : . :
rJMFF049I18- ATCAACAAGAGCCCTGTTCTGATCGATGACATCGACGATGACGACTAACTTGCCGTAGTC
JMFF014I21+ ATCAACAAGAGCCCTGTTCTGATCGATGACATCGACGATGACGACTAACTTGCCGTAGTC
rJMFF014I21- ATCAACAAGAGCCCTGTTCTGATCGATGACATCGACGATGACGACTAACTTGCCGTAGTC
JMFS046D10+ ATCAACAAGAGCCCTGTTCTGATTGATGACATCGACGATGACGACTAACTTGCCGTAGTC
JMFN004M04+ ATCAACAAGAGCCCTGTTCTGATCGATGACATCGACGATGACGACTAACTTGCCGTAGTC
JMFF049I18+ ATCAACAAGAGCCCTGTTCTGATCGATGACATCGACGATGACGACTAACTTGCCGTAGTC
rJMFF022P07- ATCAACAAGAGCCCTGTTCTGATCGATGACATCGACGATGACGACTAACTTGCCGTAGTC
rJMSF008I17- ATCAACAAGAGCCCTGTTCTGATCGATGACATCGACGATGACGACTAACTTGCCGTAGTC
JMFN035O06+ ATCAACAAGAGCCCTGTTCTGATCGATGACATCGACGATGACGACTAACTTGCCGTAGTC
JMFF022P07+ ATCAACAAGAGCCCTGTTCTGATCGATGACATCGACGATGACGACTAACTTGCCGTAGTC
JMSF008I17+ ATCAACAAGAGCCCTGTTCTGATCGATGACATCGACGATGACGACTAACTTGCCGTAGTC
rJMSF014G14- ATCAACAAGAGCCCTGTTCTGATCGATGACATCGACGATGACGACTAACTTGCCGTAGTC
JMSF014G14+ ATCAACAAGAGCCCTGTTCTGATCGATGACATCGACGATGACGACTAACTTGCCGTAGTC
                      ____________________________________________________________
consensus ATCAACAAGAGCCCTGTTCTGATCGATGACATCGACGATGACGACTAACTTGCCGTAGTC
 
. : . : . : . : . : . :
rJMFF049I18- CTTGCCATAGTTAACGAGCGCGACCCTGCCGATCTCCA
JMFF014I21+ CTTGCCATAGTTAACGAGCGCGACCCTGCCGATCTCCACGTACCTCTTGAACGGCATTTT
rJMFF014I21- CTTGCCATAGTTAACGAGCGCGACCCTGCCGATCTCCACGTACCTCTTGAACGGCATTTT
JMFS046D10+ CTTGCCATAGTTAACGAGCGCGACCCNGCCGATCTCCACGGACCTCTTGAACGGCATTTT
JMFN004M04+ CTTGCCATAGTTAACGAGCGCGACCCTGCCGATCTCCACGTACCTCTTGAACGGCATTTT
JMFF049I18+ CTTGCCATAGTTAACGAGCGCGACCCTGCCGATCTCCACGTACCTCTTGAACGGCATTTT
rJMFF022P07- CTTGCCATAGTTAACGAGCGCGACCCTGCCGATCTCCACGTACCTCTTGAACGGCATTTT
rJMSF008I17- CTTGCCATAGTTAACGAGCGCGACCCTGCCGATCTCCACGTACCTCTTGAACGGCATTTT
JMFN035O06+ CTTGCCATAGTTAACGAGCGCGACCCTGCCGATCTCCACGTACCTCTTGAACGGCATTTT
JMFF022P07+ CTTGCCATAGTTAACGAGCGCGACCCTGCCGATCTCCACGTACCTCTTGAACGGCATTTT
JMSF008I17+ CTTGCCATAGTTAACGAGCGCGACCCTGCCGATCTCCACGTACCTCTTGAACGGCATTTT
rJMSF014G14- CTTGCCATAGTTAACGAGCGCGACCCTGCCGATCTCCACGTACCTCTTGAACGGCATTTT
JMSF014G14+ CTTGCCATAGTTAACGAGCGCGACCCTGCCGATCTCCACGTACCTCTTGAACGGCATTTT
                      ____________________________________________________________
consensus CTTGCCATAGTTAACGAGCGCGACCCTGCCGATCTCCACGTACCTCTTGAACGGCATTTT
 
. : . : . : . : . : . :
JMFF014I21+ CGGCGGTCTGAAAGAGCAGGGGAACGTGAGCTTAG
rJMFF014I21- CGGCGGTCTGAAAGAGCAGGGGAACGTGAGCTTAGCCCGG
JMFN004M04+ CGGCGGTCTGAAAGAGCAGGGGAACGTGAGCTTAGGCCGGAGGGCA
JMFF049I18+ CGGCGGTCTGAAAGAGCAGGGGAACGTGAGCTTAGCCCGG
rJMFF022P07- CGGCGGTCTGAAAGAGCAGGGGAACGTGAGCTTANGCCGGAGGGCAGTAGTCCAATGTT
rJMSF008I17- CGGCGGTCTGAAAGAGCAGGGGAACGTGAGCTTAGGCCGGAGGGCAGTAGTCCAATGT
JMFN035O06+ CGGCGGTCTGAAAGAGCAGGGGAACGTGAGCTTAGGCCGGAGGGCA
JMFF022P07+ CGGCGGTCTGAAAGAGCAGGGGAACGTGAGCTTAGGCCGGAGGGCAGTAGTCCAATGTT
JMSF008I17+ CGGCGGTCTGAAAGAGCAGGGGAACGTGAGCTTAGGCCGGAGGGCAGTAGTCCAATGT
rJMSF014G14- CGGCGGTCTGAAAGAGCAGGGGAACGTGAGCTTAGGCCGGAGGGCAGTAGTCCAATGTT
JMSF014G14+ CGGCGGTCTGAAAGAGCAGGGGAACGTGAGCTTAGGCCGGAGGGCAGTAGTCCAATGTTC
                      ____________________________________________________________
consensus CGGCGGTCTGAAAGAGCAGGGGAACGTGAGCTTAGGCCGGAGGGCAGTAGTCCAATGTTC