Previous Contig 005469:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018B11Sequence606005469 (4)gb:ATAC002343_15427841e-13Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete sequence786009045 (5)gb:ATAC002343_15427841e-33Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete sequence
JMSF011D02Sequence366005469 (4)gb:ATAC002343_15427844e-06Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete sequence727009045 (5)gb:ATAC002343_15427845e-33Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete sequence
JMSF014F22Sequence229005469 (4)829009045 (5)gb:ATAC002343_15427843e-34Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete sequence
JMSF044A07Sequence782005469 (4)gb:AP005808_18582159e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN693009045 (5)pir|T47975|T479751e-31auxin response factor-like protein - Arabidopsis thaliana>gb:ATF15G16_1548709 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044A07+ TC
                      ____________________________________________________________
consensus TC
 
. : . : . : . : . : . :
JMSF044A07+ AGTAGCGTGTCTCCTTAGAACAGAAAACCCGCCATGAGGGCTTGTATNTGATGCGGTTAG
                      ____________________________________________________________
consensus AGTAGCGTGTCTCCTTAGAACAGAAAACCCGCCATGAGGGCTTGTATNTGATGCGGTTAG
 
. : . : . : . : . : . :
JMSF044A07+ AACCTTGCAGAACGAGTGAATTTTGGGGCTTGGAGGCTCAGGGGGGCATGGATTCGGATT
                      ____________________________________________________________
consensus AACCTTGCAGAACGAGTGAATTTTGGGGCTTGGAGGCTCAGGGGGGCATGGATTCGGATT
 
. : . : . : . : . : . :
JMSF044A07+ AGTTGCCTTCATTTGCTCTTCTGGCATCAAAGTAATTTGGGCATAAACCTCATCAGTGTC
                      ____________________________________________________________
consensus AGTTGCCTTCATTTGCTCTTCTGGCATCAAAGTAATTTGGGCATAAACCTCATCAGTGTC
 
. : . : . : . : . : . :
JMSF044A07+ CCGTTCAGCCAGAAGGTGAATGTTTAAAACACGGCAAAGGATCTTCGACTGCAGAGGAAA
                      ____________________________________________________________
consensus CCGTTCAGCCAGAAGGTGAATGTTTAAAACACGGCAAAGGATCTTCGACTGCAGAGGAAA
 
. : . : . : . : . : . :
JMSF044A07+ CATTGATATCCTCTGATCCATCGCTTGATTTGTCGATGCCTCCAATTGTTCCATGTGACC
                      ____________________________________________________________
consensus CATTGATATCCTCTGATCCATCGCTTGATTTGTCGATGCCTCCAATTGTTCCATGTGACC
 
. : . : . : . : . : . :
JMSF044A07+ TTGTGGAAAATAGTAAACCCATTCATCAGGTCTAGGAACATCCACCAATGGACCCGCGCA
                      ____________________________________________________________
consensus TTGTGGAAAATAGTAAACCCATTCATCAGGTCTAGGAACATCCACCAATGGACCCGCGCA
 
. : . : . : . : . : . :
JMSF011D02+ CCTGAGGGATTGCCATGCTGTCGCAG
JMFF018B11+ CCTGAGGGATTGCCATGCTGTCGCAG
JMSF044A07+ GAGCTTCCATAGATCATCATACAGATCATCCTTCCCTGAGGGATTGCCATGCTGTCGCAG
                      ____________________________________________________________
consensus GAGCTTCCATAGATCATCATACAGATCATCCTTCCCTGAGGGATTGCCATGCTGTCGCAG
 
. : . : . : . : . : . :
JMSF011D02+ AGAAGAGGAAGAGGTTCTATCCACCATCATCATTGAAACAAAAAATGTTTTTATTTGAAA
JMFF018B11+ AGAAGAGGAAGAGGTTCTATCCACCATCATCATTGAAACAAAAAATGTTTTTATTTGAAA
JMSF044A07+ AGAAGAGGAAGAGGTTCTATCCACCATCATCATTGAAACAAAAAATGTTTTTATTTGAAA
                      ____________________________________________________________
consensus AGAAGAGGAAGAGGTTCTATCCACCATCATCATTGAAACAAAAAATGTTTTTATTTGAAA
 
. : . : . : . : . : . :
JMSF011D02+ ATTCAACAAATACCCAGAAATTCTCAAGCCGAATTCACCGCAGACTTAGCATTTATTCCA
JMFF018B11+ ATTCAACAAATACCCAGAAATTCTCAAGCCGAATTCACCGCAGACTTAGCATTTATTCCA
JMSF044A07+ ATTCAACAAATACCCAGAAATTCTCAAGCCGAATTCACCGCAGACTTAGCATTTATTCCA
                      ____________________________________________________________
consensus ATTCAACAAATACCCAGAAATTCTCAAGCCGAATTCACCGCAGACTTAGCATTTATTCCA
 
. : . : . : . : . : . :
JMSF011D02+ TTCAATTCAATGGCAACAACCCGACAAATATTAAGAAGAACCCTCTAAACGGAGCAGCGA
JMFF018B11+ TTCAATTCAATGGCAACAACCCGACAAATATTAAGAAGAACCCTCTAAACGGAGCAGCGA
JMSF044A07+ TTCAATTCAATGGCAACAACCCGACAAATATTAAGAAGAACCCTCTAAACGGAGCAGCGA
JMSF014F22+ GGCAACAACCCGACAAATATTAAGAAGAACCCTCTAAACGGAGCAGCGA
                      ____________________________________________________________
consensus TTCAATTCAATGGCAACAACCCGACAAATATTAAGAAGAACCCTCTAAACGGAGCAGCGA
 
. : . : . : . : . : . :
JMSF011D02+ AAGACGCAAACTTTTCCCTCAAAATTTTGACCCTTTGCTCCCCCTTTACGTTACTACAGG
JMFF018B11+ AAGACGCAAACTTTTCCCTCAAAATTTTGACCCTTTGCTCCCCCTTTACGTTACTACAGG
JMSF044A07+ AAGACGCAAACTTTTCCCTCAAAATTTTGACCCTTTGCTCCCCCTTTACGTTACTACAGG
JMSF014F22+ AAGACGCAAACTTTTCCCTCAAAATTTTGACCCTTTGCTCCCCCTTTACGTTACTACAGG
                      ____________________________________________________________
consensus AAGACGCAAACTTTTCCCTCAAAATTTTGACCCTTTGCTCCCCCTTTACGTTACTACAGG
 
. : . : . : . : . : . :
JMSF011D02+ CTTTCAGCTC
JMFF018B11+ CTTTCAGCTCAGCAAAGCTTGGCACCAGGCTGCAGCTTATTATAACACTGCCTTCTGTTC
JMSF044A07+ CTTTCAGCTCAGCAAAGCTTGGCACCAGGCTGCAGCTTATTATAACACTGCCTTCTGTTC
JMSF014F22+ CTTTCAGCTCAGCAAAGCTTGGCACCAGGCTGCAGCTTATTATAACACTGCCTTCTGTTC
                      ____________________________________________________________
consensus CTTTCAGCTCAGCAAAGCTTGGCACCAGGCTGCAGCTTATTATAACACTGCCTTCTGTTC
 
. : . : . : . : . : . :
JMFF018B11+ TGTCTCTCTCTAGAGAATCAAAGGAGGGAGAAGGGCAAAAGAGAGAAAGAAGAAGCCGC
JMSF044A07+ TGTCTCTCTCTAGAGAATCAAAGGAGGGAGAAGGGCAAAAGAGAGAAAGAAGAAGCCGC
JMSF014F22+ TGTCTCTCTCTAGAGAATCAAAGGAGGGAGAAGGGCAAAAGAGAGAAAGAAGAAGCCGCC
                      ____________________________________________________________
consensus TGTCTCTCTCTAGAGAATCAAAGGAGGGAGAAGGGCAAAAGAGAGAAAGAAGAAGCCGCC