Previous Contig 005460:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010B07Sequence571005460 (3)gb:AK175185_18171739e-16Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-60-D20.638008633 (3)gb:AK175185_18171733e-36Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-60-D20.
JMFF031P20Sequence600005460 (3)gb:AK175185_18171738e-20Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-60-D20.649008633 (3)gb:AK175185_18171733e-37Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-60-D20.
JMSF014D06Sequence511005460 (3)gb:AK175185_18171739e-11Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-60-D20.789008633 (3)gb:AK175185_18171731e-60Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-60-D20.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF031P20+ TCTTTCCAGACTCAATAGCGACAGCCAATTGCTTCAGGACAACAGATGGA
                      ____________________________________________________________
consensus TCTTTCCAGACTCAATAGCGACAGCCAATTGCTTCAGGACAACAGATGGA
 
. : . : . : . : . : . :
JMFF031P20+ GGAATAACACCTGCATCCCAAAAAGTTTGGATCTTCCAACAAGGAACCTGATTTGATGTC
                      ____________________________________________________________
consensus GGAATAACACCTGCATCCCAAAAAGTTTGGATCTTCCAACAAGGAACCTGATTTGATGTC
 
. : . : . : . : . : . :
JMFF031P20+ CTCCTGATCAGAAATTTCTCTATCCCTCATCAAGTATAAATTTTCATCAAAAATTGCATA
JMFF010B07+ TGATCAGAAATTTCTNTATCCCTCATCAAGTATAAATTTTCATCAAAAATTGCATA
                      ____________________________________________________________
consensus CTCCTGATCAGAAATTTCTCTATCCCTCATCAAGTATAAATTTTCATCAAAAATTGCATA
 
. : . : . : . : . : . :
JMFF031P20+ TGCCATAGTTGAATTCTCAGTATCTTCTGCTCCTCGTTTCCCTATTCTTATGCTCTTAAG
JMFF010B07+ TGCCATAGTTGAATTCTCAGTATCTTCTGCTCCTCGTTTCCCTATTCTTATGCTCTTAAG
JMSF014D06+ CTCCTCGTTTCCCTATTCTTATGCTCTTAAG
                      ____________________________________________________________
consensus TGCCATAGTTGAATTCTCAGTATCTTCTGCTCCTCGTTTCCCTATTCTTATGCTCTTAAG
 
. : . : . : . : . : . :
JMFF031P20+ CCTATCTTGCCAATCCTGCTTTGTCTTTATTTGTGATGGTTTCCACCTCAAACTCTTCCC
JMFF010B07+ CCTATCTTGCCAATCCTGCTTTGTCTTTATTTGTGATGGTTTCCACCTCAAACTCTTCCC
JMSF014D06+ CCTATCTTGCCAATCCTGCTTTGTCTTTATTTGTGATGGTTTCCACCTCAAACTCTTCCC
                      ____________________________________________________________
consensus CCTATCTTGCCAATCCTGCTTTGTCTTTATTTGTGATGGTTTCCACCTCAAACTCTTCCC
 
. : . : . : . : . : . :
JMFF031P20+ TTCATTACTACCCTTAGGCGGCCCGTCCTTATTACCCACGAATCCAGGCGTTGATATCTC
JMFF010B07+ TTCATTACTACCCTTAGGCGGCCCGTCCTTATTACCCACGAATCCAGGCGTTGATATCTC
JMSF014D06+ TTCATTACTACCCTTAGGCGGCCCGTCCTTATTACCCACGAATCCAGGCGTTGATATCTC
                      ____________________________________________________________
consensus TTCATTACTACCCTTAGGCGGCCCGTCCTTATTACCCACGAATCCAGGCGTTGATATCTC
 
. : . : . : . : . : . :
JMFF031P20+ CGGCGACTGCTGATCAGAATCATCTCCAACTTGAATTTTAAAATGTTCAGCATTATCTGG
JMFF010B07+ CGGCGACTGCTGATCAGAATCATCTCCAACTTGAATTTTAAAATGTTCAGCATTATCTGG
JMSF014D06+ CGGCGACTGCTGATCAGAATCATCTCCAACTTGAATTTTAAAATGTTCAGCATTATCTGG
                      ____________________________________________________________
consensus CGGCGACTGCTGATCAGAATCATCTCCAACTTGAATTTTAAAATGTTCAGCATTATCTGG
 
. : . : . : . : . : . :
JMFF031P20+ ATCAATGGAGGGATCAGATTTTTTAATATCCGTAAAGACTTTCTCCGCTTTAGCTGCAGC
JMFF010B07+ ATCAATGGAGGGATCAGATTTTTTAATATCCGTAAAGACTTTCTCCGCTTTAGCTGCAGC
JMSF014D06+ ATCAATGGAGGGATCAGATTTTTTAATATCCGTAAAGACTTTCTCCGCTTTAGCTGCAGC
                      ____________________________________________________________
consensus ATCAATGGAGGGATCAGATTTTTTAATATCCGTAAAGACTTTCTCCGCTTTAGCTGCAGC
 
. : . : . : . : . : . :
JMFF031P20+ CGAATGGAAGGCCGTCCGAGCCCTGGAGACGAAGGACGGTTCCATTTCGAGCGAAGGGAG
JMFF010B07+ CGAATGGAAGGCCGTCCGAGCCCTGGAGACGAAGGACGGTTCCATTTCGAGCGAAGGGAG
JMSF014D06+ CGAATGGAAGGCCGTCCGAGCCCTGGAGACGAAGGACGGTTCCATTTCGAGCGAAGGGAG
                      ____________________________________________________________
consensus CGAATGGAAGGCCGTCCGAGCCCTGGAGACGAAGGACGGTTCCATTTCGAGCGAAGGGAG
 
. : . : . : . : . : . :
JMFF031P20+ TGTAGGATAAGCGAGAGCCAATCGAAATTTCAACAGCCAGATTGACAAGGAAGGAAGAGC
JMFF010B07+ TGTAGGATAAGCGAGAGCCAATCGAAATTTCAACAGCCAGATTGACAAGGAAGGAAGAGC
JMSF014D06+ TGTAGGATAAGCGAGAGCCAATCGAAATTTCAACAGCCAGATTGACAAGGAAGGAAGAGC
                      ____________________________________________________________
consensus TGTAGGATAAGCGAGAGCCAATCGAAATTTCAACAGCCAGATTGACAAGGAAGGAAGAGC
 
. : . : . : . : . : . :
JMFF031P20+ TGAATCGAGC
JMFF010B07+ TGAATCGAGCAAGTCTAACAGATTCAACACTGCTGTTGTTGTAGACCAGAGGCACCCAGT
JMSF014D06+ TGAATCGAGCAAGTCTAACAGATTCAACACTGCTGTTGTTGTAGACCAGAGGCACCCAGT
                      ____________________________________________________________
consensus TGAATCGAGCAAGTCTAACAGATTCAACACTGCTGTTGTTGTAGACCAGAGGCACCCAGT
 
. : . : . : . : . : . :
JMFF010B07+ TTTCTACGGAGTTTTTTTTTCCTTTTTTAAATTT
JMSF014D06+ TTTCTACGGAGTTTTTTTTTCCTTTTTTAAATTTGCTCTGTAAATTTAGCAAAGGCCCTC
                      ____________________________________________________________
consensus TTTCTACGGAGTTTTTTTTTCCTTTTTTAAATTTGCTCTGTAAATTTAGCAAAGGCCCTC