Previous Contig 005458:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF014C24Sequence236005458 (3)729013343 (3)gb:AY096649_15761862e-55Arabidopsis thaliana unknown protein (At4g09580) mRNA, complete cds.>gb:AY114042
JMSF024D16Sequence611005458 (3)gb:AY096649_15761865e-18Arabidopsis thaliana unknown protein (At4g09580) mRNA, complete cds.>gb:AY114042307013343 (3)
JMSF041G19Sequence763005458 (3)gb:AY096649_15761861e-42Arabidopsis thaliana unknown protein (At4g09580) mRNA, complete cds.>gb:AY114042618013343 (3)gb:AY096649_15761867e-29Arabidopsis thaliana unknown protein (At4g09580) mRNA, complete cds.>gb:AY114042

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041G19+ AAGAACACCGAAAAGTGCTCCAGCAAGTAATGACATAAAAATG
                      ____________________________________________________________
consensus AAGAACACCGAAAAGTGCTCCAGCAAGTAATGACATAAAAATG
 
. : . : . : . : . : . :
JMSF041G19+ GTCCCGGGAATCATGAATGTCTGCATAAATATGTATGTTGAGCAGTAACCCAAAATGAAT
                      ____________________________________________________________
consensus GTCCCGGGAATCATGAATGTCTGCATAAATATGTATGTTGAGCAGTAACCCAAAATGAAT
 
. : . : . : . : . : . :
JMSF041G19+ CTCGTTGGGTACATATCGGCATACATAGCTAGGTGATCCTTGAGCATCCGAAGATCAGAA
JMSF024D16+ GAAGATCAGAA
                      ____________________________________________________________
consensus CTCGTTGGGTACATATCGGCATACATAGCTAGGTGATCCTTGAGCATCCGAAGATCAGAA
 
. : . : . : . : . : . :
JMSF041G19+ ATATTACGAGGAAGCTTGAGTTTCCCATAATCTGCAGCAGGCATTGTCAAGTAGATGCAG
JMSF024D16+ ATATTACGAGGAAGCTTGAGTTTCCCATAATCTGCAGCAGGCATTGTCAAGTAGATGCAG
                      ____________________________________________________________
consensus ATATTACGAGGAAGCTTGAGTTTCCCATAATCTGCAGCAGGCATTGTCAAGTAGATGCAG
 
. : . : . : . : . : . :
JMSF041G19+ AACAAGCCTGTCAAGCACACCATGAACACCACAAGAGCCGCGGCGAACTCCCAACGGCTG
JMSF024D16+ AACAAGCCTGTCAAGCACACCATGAACACCACAAGAGCCGCGGCGAACTCCCAACGGCTG
                      ____________________________________________________________
consensus AACAAGCCTGTCAAGCACACCATGAACACCACAAGAGCCGCGGCGAACTCCCAACGGCTG
 
. : . : . : . : . : . :
JMSF041G19+ AGCAGGAACTTGCCCTCTTTGTAACGTTTGGCTGTCGGCGAGTCCGAGGAATAGGAGTCG
JMSF024D16+ AGCAGGAACTTGCCCTCTTTGTAACGTTTGGCTGTCGGCGAGTCCGAGGAATAGGAGTCG
                      ____________________________________________________________
consensus AGCAGGAACTTGCCCTCTTTGTAACGTTTGGCTGTCGGCGAGTCCGAGGAATAGGAGTCG
 
. : . : . : . : . : . :
JMSF041G19+ GACAAATCGAGAATCTTCTCCTCATCTCTGGCCAAGCGCGACGTGTCCACCACCAAACCC
JMSF024D16+ GACAAATCGAGAATCTTCTCCTCATCTCTGGCCAAGCGCGACGTGTCCACCACCAAACCC
                      ____________________________________________________________
consensus GACAAATCGAGAATCTTCTCCTCATCTCTGGCCAAGCGCGACGTGTCCACCACCAAACCC
 
. : . : . : . : . : . :
JMSF041G19+ CTGGGCGCCGCCATTGACGACCACAACGCAGATGGATGGCGATCTTTATGGTGATGACGA
JMSF024D16+ CTGGGCGCCGCCATTGACGACCACAACGCAGATGGATGGCGATCTTTATGGTGATGACGA
                      ____________________________________________________________
consensus CTGGGCGCCGCCATTGACGACCACAACGCAGATGGATGGCGATCTTTATGGTGATGACGA
 
. : . : . : . : . : . :
JMSF041G19+ TATCAATAACACCCTATGCTTCACTCATTTGGGCAGGGCCTCGTCTAGGGCTTGTTGATC
JMSF024D16+ TATCAATAACACCCTATGCTTCACTCATTTGGGCAGGGCCTCGTCTAGGGCTTGTTGATC
                      ____________________________________________________________
consensus TATCAATAACACCCTATGCTTCACTCATTTGGGCAGGGCCTCGTCTAGGGCTTGTTGATC
 
. : . : . : . : . : . :
JMSF041G19+ CAAAAGGAAATGAAGAAATCTAGGGTTTGTGATTTCGGATTCAACGAATCAGTAGAAATT
JMSF024D16+ CAAAAGGAAATGAAGAAATCTAGGGTTTGTGATTTCGGATTCAACGAATCAGTAGAAATT
JMSF014C24+ AGGAAATGAAGAAATCTAGGGTTTGTGATTTCGGATTCAACGAATCAGTAGAAATT
                      ____________________________________________________________
consensus CAAAAGGAAATGAAGAAATCTAGGGTTTGTGATTTCGGATTCAACGAATCAGTAGAAATT
 
. : . : . : . : . : . :
JMSF041G19+ TTCTTTTAAAAAATTTAAAATTCCCAAAGAGAACGAAAAAGATTGAATTTTTAGATGAAA
JMSF024D16+ TTCTTTTAAAAAATTTAAAATTCCCAAAGAGAACGAAAAAGATTGAATTTTTAGATGAAA
JMSF014C24+ TTCTTTTAAAAAATTTAAAATTCCCAAAGAGAACGAAAAAGATTGAATTTTTAGATGAAA
                      ____________________________________________________________
consensus TTCTTTTAAAAAATTTAAAATTCCCAAAGAGAACGAAAAAGATTGAATTTTTAGATGAAA
 
. : . : . : . : . : . :
JMSF041G19+ GACAAGAAAACGGAAGCTGAAATCGGAGGCAAACAGGAAAAAAACAAAGGTTGAAGTATT
JMSF024D16+ GACAAGAAAACGGAAGCTGAAATCGGAGGCAAACAGGAAAAAAACAAAGGTTGAAGTATT
JMSF014C24+ GACAAGAAAACGGAAGCTGAAATCGGAGGCAAACAGGAAAAAAACAAAGGTTGAAGTATT
                      ____________________________________________________________
consensus GACAAGAAAACGGAAGCTGAAATCGGAGGCAAACAGGAAAAAAACAAAGGTTGAAGTATT
 
. : . : . : . : . : . :
JMSF041G19+ AGGAATTGGCAATTTGGGATATTTTCTTGGAATCCATTGGGTTGTTTGAATTTTTGT
JMSF024D16+ AGGAATTGGCAATTTGGGATATTTTCTTGGAATCCATTGGGTTGTTTGAATTTTTGT
JMSF014C24+ AGGAATTGGCAATTTGGGATATTTTCTTGGAATCCATTGGGTTGTTTGAATTTTTGTTCC
                      ____________________________________________________________
consensus AGGAATTGGCAATTTGGGATATTTTCTTGGAATCCATTGGGTTGTTTGAATTTTTGTTCC