Previous Contig 005456:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS011F04Sequence627005456 (2)gb:AC006072_15334202e-37Arabidopsis thaliana chromosome 2 clone T9J23 map CIC06C03, complete sequence.
JMSF014C10Sequence224005456 (2)780022599gb:ATORF101_15537971e-73A.thaliana mRNA for unknown protein (cDNA101).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS011F04+ AAAATAATGTCAATCACAAGA
                      ____________________________________________________________
consensus AAAATAATGTCAATCACAAGA
 
. : . : . : . : . : . :
JMFS011F04+ GTGCCATGCTCCTCGGCCCGTCTGCCAAATATCTGAGAGAAATGGAGAACAGAGTCCAAG
                      ____________________________________________________________
consensus GTGCCATGCTCCTCGGCCCGTCTGCCAAATATCTGAGAGAAATGGAGAACAGAGTCCAAG
 
. : . : . : . : . : . :
JMFS011F04+ TAATCCATGACCTTTTCATTGATTGGCATGCATACGTGCATTTTAAGTGTGAATATGTGT
                      ____________________________________________________________
consensus TAATCCATGACCTTTTCATTGATTGGCATGCATACGTGCATTTTAAGTGTGAATATGTGT
 
. : . : . : . : . : . :
JMFS011F04+ CTTTTCAGGAGTTCCATATAAAGCCTGAAGGCTGCAGGTCGCAAATGACGATTTGGGATA
                      ____________________________________________________________
consensus CTTTTCAGGAGTTCCATATAAAGCCTGAAGGCTGCAGGTCGCAAATGACGATTTGGGATA
 
. : . : . : . : . : . :
JMFS011F04+ ACCCTATTGGATAGCAGTGGAAAGACAATGAGAGAAGGCACAATCTTGAGAACCAAGGCC
                      ____________________________________________________________
consensus ACCCTATTGGATAGCAGTGGAAAGACAATGAGAGAAGGCACAATCTTGAGAACCAAGGCC
 
. : . : . : . : . : . :
JMFS011F04+ TTCTCCAACAATTTCCAAGCAGAGGGCACATTATTCTCCCAGCAAATGTGAGACACCAAG
                      ____________________________________________________________
consensus TTCTCCAACAATTTCCAAGCAGAGGGCACATTATTCTCCCAGCAAATGTGAGACACCAAG
 
. : . : . : . : . : . :
JMFS011F04+ AGATGGGCCAGGTGAATAGAAGGCAGAGGCGCTCCAGCTGAGGTCAAATGTGAGGAAACT
                      ____________________________________________________________
consensus AGATGGGCCAGGTGAATAGAAGGCAGAGGCGCTCCAGCTGAGGTCAAATGTGAGGAAACT
 
. : . : . : . : . : . :
JMFS011F04+ TGAATTGCCCACACCAAAGGGTCACAACCCTTCTCTTGGGCCACCTTCGTTAGCTCCAAA
                      ____________________________________________________________
consensus TGAATTGCCCACACCAAAGGGTCACAACCCTTCTCTTGGGCCACCTTCGTTAGCTCCAAA
 
. : . : . : . : . : . :
JMFS011F04+ ACATCATCCCAGATGCTGCTGCACTGTACAGACACCTCCATCACATCACTCTCTCATATC
JMSF014C10+ TGCTGCACTGTACAGACACCTCCATCACATCACTCTCTCATATC
                      ____________________________________________________________
consensus ACATCATCCCAGATGCTGCTGCACTGTACAGACACCTCCATCACATCACTCTCTCATATC
 
. : . : . : . : . : . :
JMFS011F04+ CCTTTTCTTTCCTACTCAGAGTCAGAGACCTCTGTTACTGGATGTATGGGAAATTGGGGA
JMSF014C10+ CCTTTTCTTTCCTACTCAGAGTCAGAGACCTCTGTTACTGGATGTATGGGAAATTGGGGA
                      ____________________________________________________________
consensus CCTTTTCTTTCCTACTCAGAGTCAGAGACCTCTGTTACTGGATGTATGGGAAATTGGGGA
 
. : . : . : . : . : . :
JMFS011F04+ TTGGGGATTGGGGACTGGGGATGAGGAGTCTTGCAGAGTTTTTTACCAGAAGAATAATGA
JMSF014C10+ TTGGGGATTGGGGACTGGGGATGAGGAGTCTTGCAGAGTTTTTTACCAGAAGAATAATGA
                      ____________________________________________________________
consensus TTGGGGATTGGGGACTGGGGATGAGGAGTCTTGCAGAGTTTTTTACCAGAAGAATAATGA
 
. : . : . : . : . : . :
JMFS011F04+ ATCCTT
JMSF014C10+ ATCCTTTGGAGTTTTGAGAGTGGGAAGTTGTGGGAGTGGAGACTATTTGGTGGTGCAGTC
                      ____________________________________________________________
consensus ATCCTTTGGAGTTTTGAGAGTGGGAAGTTGTGGGAGTGGAGACTATTTGGTGGTGCAGTC