Previous Contig 005455:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS002C10Sequence463005455 (8)gb:AY051008_15624854e-33Arabidopsis thaliana putative HSP protein (At4g16660) mRNA, complete cds.
JMFS008G04Sequence600005455 (8)gb:AY051008_15624854e-45Arabidopsis thaliana putative HSP protein (At4g16660) mRNA, complete cds.
JMFS029A10Sequence594005455 (8)gb:AY051008_15624851e-46Arabidopsis thaliana putative HSP protein (At4g16660) mRNA, complete cds.
JMFS075G04Sequence627005455 (8)gb:AY051008_15624856e-49Arabidopsis thaliana putative HSP protein (At4g16660) mRNA, complete cds.
JMFS104B10Sequence594005455 (8)gb:AY051008_15624853e-45Arabidopsis thaliana putative HSP protein (At4g16660) mRNA, complete cds.
JMFS127G07Sequence600005455 (8)gb:AY051008_15624854e-45Arabidopsis thaliana putative HSP protein (At4g16660) mRNA, complete cds.
JMSF005C15Sequence236005455 (8)gb:AY051008_15624858e-08Arabidopsis thaliana putative HSP protein (At4g16660) mRNA, complete cds.
JMSF014C08Sequence486005455 (8)gb:AY051008_15624854e-33Arabidopsis thaliana putative HSP protein (At4g16660) mRNA, complete cds.781004137 (2)gb:AP003983_18359017e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS029A10+ GAGCTCGGCGGCAGTAAGCAGCCCATTTCTCTCT
JMFS075G04+ GCACATTGATCCCCGCGAGCTCGGCGGCAGTAAGCAGCCCATTTCTCTCT
JMFS127G07+ CAGTAAGCAGCCCATTTCTCTCT
JMFS104B10+ GCAGCCCATTTCTCTCT
JMFS008G04+ CAGTAAGCAGCCCATTTCTCTCT
                      ____________________________________________________________
consensus GCACATTGATCCCCGCGAGCTCGGCGGCAGTAAGCAGCCCATTTCTCTCT
 
. : . : . : . : . : . :
JMFS029A10+ GCGACGCCCATGAATGGAGGCACTGTTATTACTGCATCCTTCACTGAACCGCNCCGCACG
JMFS075G04+ GCGACGCCCATGAATGGAGGCACTGTTATTACTGCATCCTTCACTGAACCGCCCCGCACG
JMFS127G07+ GCGACGCCCATGAATGGAGGCACTGTTATTACTGCATCCTTCACTGAACCGCCCCGCACG
JMFS104B10+ GCGACGCCCATGAATGGAGGCACTGTTATTACTGCATCCTTCACTGAACCGCNCCGCACG
JMFS008G04+ GCGACGCCCATGAATGGAGGCACTGTTATTACTGCATCCTTCACTGAACCGCCCCGCACG
                      ____________________________________________________________
consensus GCGACGCCCATGAATGGAGGCACTGTTATTACTGCATCCTTCACTGAACCGCCCCGCACG
 
. : . : . : . : . : . :
JMFS029A10+ TGCGTCTCCGCGAGCCCAATCGCGTACTTCAACACCATCGCCACCAGCTCCTCTGCCGTG
JMFS075G04+ TGCGTCTCCGCGAGCCCAATCGCGTACTTCAACACCATCGCCACCAGCTCCTCTGCCGTG
JMFS127G07+ TGCGTCTCCGCGAGCCCAATCGCGTACTTCAACACCATCGCCACCAGCTCCTCTGCCGTG
JMFS104B10+ TGCGTCTCCGCGAGCCCAATCGCGTACTTCAACACCATCGCCACCAGCTCCTCTGCCGTG
JMFS008G04+ TGCGTCTCCGCGAGCCCAATCGCGTACTTCAACACCATCGCCACCAGCTCCTCTGCCGTG
JMFS002C10+ GCCGTG
JMSF014C08+ GCCGTG
                      ____________________________________________________________
consensus TGCGTCTCCGCGAGCCCAATCGCGTACTTCAACACCATCGCCACCAGCTCCTCTGCCGTG
 
. : . : . : . : . : . :
JMFS029A10+ AAATTCCCGTTCTCGGTACGGAAAGCCGCGACATTCCTCGTCTCCTCCGGAAAAACGTCG
JMFS075G04+ AAATTCCCGTTCTCGGTACGGAAAGCCGCGACATTCCTCGTCTCCTCCGGAAAAACGTCG
JMFS127G07+ AAATTCCCGTTCTCGGTACGGAAAGCCGCGACATTCCTCGTCTCCTCCGGAAAAACGTCG
JMFS104B10+ AAATTCCCGTTCTCGGTACGGAAAGCCGCGACATTCCTCGTCTCCTCCGGAAAAACGTCG
JMFS008G04+ AAATTCCCGTTCTCGGTACGGAAAGCCGCGACATTCCTCGTCTCCTCCGGAAAAACGTCG
JMFS002C10+ AAATTCCCGTTCTCGGTACGGAAAGCCGCGACATTCCTCGTCTCCTCCGGAAAAACGTCG
JMSF014C08+ AAATTCCCGTTCTCGGTACGGAAAGCCGCGACATTCCTCGTCTCCTCCGGAAAAACGTCG
                      ____________________________________________________________
consensus AAATTCCCGTTCTCGGTACGGAAAGCCGCGACATTCCTCGTCTCCTCCGGAAAAACGTCG
 
. : . : . : . : . : . :
JMFS029A10+ TGTTTTAAATACAGGGAGTCTAGGGATTTGACGACGTGATCGTAGGGTTTAGCGATGAGT
JMFS075G04+ TGTTTTAAATACAGGGAGTCTAGGGATTTGACGACGTGATCGTAGGGTTTAGCGATGAGT
JMFS127G07+ TGTTTTAAATACAGGGAGTCTAGGGATTTGACGACGTGATCGTAGGGTTTAGCGATGAGT
JMFS104B10+ TGTTTTAAATACAGGGAGTCTAGGGATTTGACGACGTGATCGTAGGGTTTAGCGATGAGT
JMFS008G04+ TGTTTTAAATACAGGGAGTCTAGGGATTTGACGACGTGATCGTAGGGTTTAGCGATGAGT
JMFS002C10+ TGTTTTAAATACAGGGAGTCTAGGGATTTGACGACGTGATCGTAGGGTTTAGCGATGAGT
JMSF014C08+ TGTTTTAAATACAGGGAGTCTAGGGATTTGACGACGTGATCGTAGGGTTTAGCGATGAGT
                      ____________________________________________________________
consensus TGTTTTAAATACAGGGAGTCTAGGGATTTGACGACGTGATCGTAGGGTTTAGCGATGAGT
 
. : . : . : . : . : . :
JMFS029A10+ TCTCGAAGATGGGAATAAACCTTGTCCGGATAGCGCGCGAGGAGGCCCGACGCCTCCTCG
JMFS075G04+ TCTCGAAGATGGGAATAAACCTTGTCCGGATAGCGCGCGAGGAGGCCCGACGCCTCCTCG
JMFS127G07+ TCTCGAAGATGGGAATAAACCTTGTCCGGATAGCGCGCGAGGAGGCCCGACGCCTCCTCG
JMFS104B10+ TCTCGAAGATGGGAATAAACCTTGTCCGGATAGCGCGCGAGGAGGCCCGACGCCTCCTCG
JMFS008G04+ TCTCGAAGATGGGAATAAACCTTGTCCGGATAGCGCGCGAGGAGGCCCGACGCCTCCTCG
JMFS002C10+ TCTCGAAGATGGGAATAAACCTTGTCCGGATAGCGCGCGAGGAGGCCCGACGCCTCCTCG
JMSF014C08+ TCTCGAAGATGGGAATAAACCTTGTCCGGATAGCGCGCGAGGAGGCCCGACGCCTCCTCG
                      ____________________________________________________________
consensus TCTCGAAGATGGGAATAAACCTTGTCCGGATAGCGCGCGAGGAGGCCCGACGCCTCCTCG
 
. : . : . : . : . : . :
JMFS029A10+ CCGATTAGCCTCGCCCCGGAATGGAATGCGACTAACGACGGGCTTTTGCGCTTCGACATC
JMFS075G04+ CCGATTAGCCTCGCCCCGGAATGGAATGCGACTAACGACGGGCTTTTGCGCTTCGACATC
JMFS127G07+ CCGATTAGCCTCGCCCCGGAATGGAATGCGACTAACGACGGGCTTTTGCGCTTCGACATC
JMFS104B10+ CCGATTAGCCTCGCCCCGGAATGGAATGCGACTAACGACGGGCTTTTGCGCTTCGACATC
JMFS008G04+ CCGATTAGCCTCGCCCCGGAATGGAATGCGACTAACGACGGGCTTTTGCGCTTCGACATC
JMFS002C10+ CCGATTAGCCTCGCCCCGGAATGGAATGCGACTAACGACGGGCTTTTGCGCTTCGACATC
JMSF005C15+ CATC
JMSF014C08+ CCGATTAGCCTCGCCCCGGAATGGAATGCGACTAACGACGGGCTTTTGCGCTTCGACATC
                      ____________________________________________________________
consensus CCGATTAGCCTCGCCCCGGAATGGAATGCGACTAACGACGGGCTTTTGCGCTTCGACATC
 
. : . : . : . : . : . :
JMFS029A10+ TCATTGATGGCGATCGAGATTGGCGGTTGCCCCGGTTTCAGGTTGACCACGGCGACTTTC
JMFS075G04+ TCATTGATGGCGATCGAGATTGGCGGTTGCCCCGGTTTCAGGTTGACCACGGCGACTTTC
JMFS127G07+ TCATTGATGGCGATCGAGATTGGCGGTTGCCCCGGTTTCAGGTTGACCACGGCGACTTTC
JMFS104B10+ TCATTGATGGCGATCGAGATTGGCGGTTGCCCCGGTTTCAGGTTGACCACGGCGACTTTC
JMFS008G04+ TCATTGATGGCGATCGAGATTGGCGGTTGCCCCGGTTTCAGGTTGACCACGGCGACTTTC
JMFS002C10+ TCATTGATGGCGATCGAGATTGGCGGTTGCCCCGGTTTCAGGTTGACCACGGCGACTTTC
JMSF005C15+ TCATTGATGGCGATCGAGATTGGCGGTTGCCCCGGTTTCAGGTTGACCACGGCGACTTTC
JMSF014C08+ TCATTGATGGCGATCGAGATTGGCGGTTGCCCCGGTTTCAGGTTGACCACGGCGACTTTC
                      ____________________________________________________________
consensus TCATTGATGGCGATCGAGATTGGCGGTTGCCCCGGTTTCAGGTTGACCACGGCGACTTTC
 
. : . : . : . : . : . :
JMFS029A10+ ATGGATTCAGATCCCAGATCTATGCTGGAAACAGCGGCATGACAGCAAATTGAGTTGAGC
JMFS075G04+ ATGGATTCAGATCCCAGATCTATGCTGGAAACAGCGGCATGACAGCAAATTGAGTTGAGC
JMFS127G07+ ATGGATTCAGATCCCAGATCTATGCTGGAAACAGCGGCATGACAGCAAATTGAGTTGAGC
JMFS104B10+ ATGGATTCAGATCCCAGATCTATGCTGGAAACAGCGGCATGACAGCAAATTGAGTTGAGC
JMFS008G04+ ATGGATTCAGATCCCAGATCTATGCTGGAAACAGCGGCATGACAGCAAATTGAGTTGAGC
JMFS002C10+ ATGGATTCAGATCCCAGATCTATGCTGGAAACAGCGGCATGACAGCAAATTGAGTTGAGC
JMSF005C15+ ATGGATTCAGATCCCAGATCTATGCTGGAAACAGCGGCATGACAGCAAATTGAGTTGAGC
JMSF014C08+ ATGGATTCAGATCCCAGATCTATGCTGGAAACAGCGGCATGACAGCAAATTGAGTTGAGC
                      ____________________________________________________________
consensus ATGGATTCAGATCCCAGATCTATGCTGGAAACAGCGGCATGACAGCAAATTGAGTTGAGC
 
. : . : . : . : . : . :
JMFS029A10+ AAGAGCAGGGATAAAAATATCCCTATCCGGAAAAGCATTGTGTCCACCGTCGCCGGAACT
JMFS075G04+ AAGAGCAGGGATAAAAATATCCCTATCCGGAAAAGCATTGTGTCCACCGTCGCCGGAACT
JMFS127G07+ AAGAGCAGGGATAAAAATATCCCTATCCGGAAAAGCATTGTGTCCACCGTCGCCGGAACT
JMFS104B10+ AAGAGCAGGGATAAAAATATCCCTATCCGGAAAAGCATTGTGTCCACCGTCGCCGGAACT
JMFS008G04+ AAGAGCAGGGATAAAAATATCCCTATCCGGAAAAGCATTGTGTCCACCGTCGCCGGAACT
JMFS002C10+ AAGAGCAGGGATAAAAATATCCCTATCCGGAAAAGCATTGTGTCCACCGTCGCCGGAACT
JMSF005C15+ AAGAGCAGGGATAAAAATATCCCTATCCGGAAAAGCATTGTGTCCACCGTCGCCGGAACT
JMSF014C08+ AAGAGCAGGGATAAAAATATCCCTATCCGGAAAAGCATTGTGTCCACCGTCGCCGGAACT
                      ____________________________________________________________
consensus AAGAGCAGGGATAAAAATATCCCTATCCGGAAAAGCATTGTGTCCACCGTCGCCGGAACT
 
. : . : . : . : . : . :
JMFS029A10+ CCTCCGCAAATGAACGAGTC
JMFS075G04+ CCTCCGCAAATGAACGAGTCCGTTACCGGAGATTAAA
JMFS127G07+ CCTCCGCAAATGAACGAGTCCGTTACCGGAGATTAAA
JMFS104B10+ CCTCCGCAAATGAACGAGTCCGTTACCGGAGATTAAA
JMFS008G04+ CCTCCGCAAATGAACGAGTCCGTTACCGGAGATTAAA
JMFS002C10+ CCTCCGCAAATGAACGAGTCCGTTACCGGAGATTAAA
JMSF005C15+ CCTCCGCAAATGAACGAGTCCGTTACCGGAGATTAAACTGGGATGAAGGTC
JMSF014C08+ CCTCCGCAAATGAACGAGTCCGTTACCGGAGATTAAACTGGGATGAAGGTCGGAGAACTC
                      ____________________________________________________________
consensus CCTCCGCAAATGAACGAGTCCGTTACCGGAGATTAAACTGGGATGAAGGTCGGAGAACTC