Previous Contig 005451:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002P13Sequence750005451 (11)sp|P92792|OM20_SOLTU1e-67Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kD
JMFF019D16Sequence570005451 (11)sp|P92792|OM20_SOLTU5e-68Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kD726005451 (11)sp|P92792|OM20_SOLTU8e-73Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kD
JMFF020O04Sequence495005451 (11)sp|P92792|OM20_SOLTU2e-54Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kD741005451 (11)pir|D86399|D863999e-27protein F17L21.18 [imported] - Arabidopsis thaliana>gb:AE005172_891617 Arabidops
JMFN035O11Sequence605005451 (11)sp|P92792|OM20_SOLTU2e-76Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kD
JMFN044H04Sequence573005451 (11)sp|P92792|OM20_SOLTU7e-38Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kD
JMSF014B09Sequence237005451 (11)sp|P92792|OM20_SOLTU3e-16Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kD759005451 (11)sp|P92792|OM20_SOLTU2e-78Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kD
JMSF024L06Sequence676005451 (11)sp|P92792|OM20_SOLTU1e-81Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kD748005451 (11)sp|P92792|OM20_SOLTU8e-76Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kD

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN044H04+ ATGCAGCAGCTAAAATTTCAAATTCAACAAAACAAATATA
rJMFF002P13- GGTACTTATGCAGCAGCTAAAATTTC-AATTCAACAAAACAAATATA
                      ____________________________________________________________
consensus GGTACTTATGCAGCAGCTAAAATTTCAAATTCAACAAAACAAATATA
 
. : . : . : . : . : . :
JMFN044H04+ GAAAACAAAGATCAGCATTCTCAAGAGATAGGAATAAGAAAAATAAAATTACTGGTTATT
rJMFF002P13- GAAAACAAAGATCAGCATTCTCAAGAGATAGGAATAAGAAAAATAAAATTACTGGTTATT
rJMFF019D16- AAGATCAGCATTCTCAAGAGATAGGAATAAGAAAAATAAAATTACTGGTTATT
rJMFF020O04- AAGATCAGCATTCTCAAGAGATAGGAATAAGAAAAATAAAATTACTGGTTATT
rJMSF024L06- AAGATCAGCATTCTCAAGAGATAGGAATAAGAAAAATAAAATTACTGGTTATT
rJMSF014B09- AAGATCAGCATTCTC-AGAGATAGGAATAAGAAAAATAAAATTACTGGTTATT
                      ____________________________________________________________
consensus GAAAACAAAGATCAGCATTCTCAAGAGATAGGAATAAGAAAAATAAAATTACTGGTTATT
 
. : . : . : . : . : . :
JMFN044H04+ GAGTCTATTCCGTAGGTCTGATAGAAACTAAGACGAGGCCATTACACGACCAAAACATGA
rJMFF002P13- GAGTCTATTCCGTAGGTCTGATAGAAACTAAGACGAGGCCATTACACGACCAAAACATGA
rJMFF019D16- GAGTCTATTCCGTAGGTCTGATAGAAACTAAGACGAGGCCATTACACGACCAAAACATGA
rJMFF020O04- GAGTCTATTCCGTAGGTCTGATAGAAACTAAGACGAGGCCATTACACGACCAAAACATGA
rJMSF024L06- GAGTCTATTCCGTAGGTCTGATAGAAACTAAGACGAGGCCATTACACGACCAAAACATGA
rJMSF014B09- GAGTCTATTCCGTAGGTCTGATAGAAACTAAGACGAGGCCATTACACGACCAAAACATGA
                      ____________________________________________________________
consensus GAGTCTATTCCGTAGGTCTGATAGAAACTAAGACGAGGCCATTACACGACCAAAACATGA
 
. : . : . : . : . : . :
JMFN044H04+ GGAAAAAATTTCTGCAACTCCAGCAAGTATCCTATTATCCAGAGCTTTGAGTATAGCTGA
rJMFF002P13- GGAAAAAATTTCTGCAACTCCAGCAAGTATCCTATTATCCAGAGCTTTGAGTATAGCTGA
rJMFF019D16- GGAAAAAATTTCTGCAACTCCAGCAAGTATCCTATTATCCAGAGCTTTGAGTATAGCTGA
rJMFF020O04- GGAAAAAATTTCTGCAACTCCAGCAAGTATCCTATTATCCANAGCTTTGAGTATAGCTGA
rJMSF024L06- GGAAAAAATTTCTGCAACTCCAGCAAGTATCCTATTATCCAGAGCTTTGAGTATAGCTGA
rJMSF014B09- GGAAAAAATTTCTGCAACTCCAGCAAGTATCCTATTATCCAGAGCTTTGAGTATAGCTGA
                      ____________________________________________________________
consensus GGAAAAAATTTCTGCAACTCCAGCAAGTATCCTATTATCCAGAGCTTTGAGTATAGCTGA
 
. : . : . : . : . : . :
JMFN044H04+ ATGTGTTCTGCTTATCTCGGTGGAGGGGGAACCTGAGATTTCGCAAAGCCCACCCATGCA
rJMFF002P13- ATGTGTTCTGCTTATCTCGGTGGAGGGGGAACCTGAGATTTCGCAAAGCCCACCCATGCA
rJMFF019D16- ATGTGTTCTGCTTATCTCGGTGGAGGGGGAACCTGAGATTTCGCAAAGCCCACCCATGCA
rJMFF020O04- ATGTGTTCTGCTTATCTCGGTGGAGGGGGAACCTGAGATTTCGCAAAGCCCACCCATGCA
rJMSF024L06- ATGTGTTCTGCTTATCTCGGTGGAGGGGGAACCTGAGATTTCGCAAAGCCCACCCATGCA
rJMSF014B09- ATGTGTTCTGCTTATCTCGGTGGAGGGGGAACCTGAGATTTCGCAAAGCCCACCCATGCA
JMFN035O11+ GGAACCTGAGATTTCGCAAAGCCCACCCATGCA
JMSF024L06+ TGAGATTTCGCAAAGCCCACCCATGCA
                      ____________________________________________________________
consensus ATGTGTTCTGCTTATCTCGGTGGAGGGGGAACCTGAGATTTCGCAAAGCCCACCCATGCA
 
. : . : . : . : . : . :
JMFN044H04+ AC-AATACCAACAGCAAGTATAATCCATCCAAAAATGTCATACTTAAGATCACTGCTCTT
rJMFF002P13- AC-AATACCAACAGCAAGTATAATCCATCCAAAAATGTCATACTTAAGATCACTGCTCTT
rJMFF019D16- AC-AATACCAACAGCAAGTATAATCCATCCAAAAATGTCATACTTAAGATCACTGCTCTT
rJMFF020O04- AC-AATACCAACAGCAAGTATAATCCATCCAAAAATGTCATACTTAAGATCACTGCTCTT
rJMSF024L06- AC-AATACCAACAGCAAGTATAATCCATCCAAAAATGTCATACTTAAGATCACTGCTCTT
rJMSF014B09- AC-AATACCAACAGCAAGTATAATCCATCCAAAAATGTCATACTTAAGATCACTGCTCTT
JMFN035O11+ ACAAATACCAACAGCAAGTATAATCCATCCAAAAATGTCATACTTAAGATCACTGCTCTT
JMSF024L06+ AC-AATACCAACAGCAAGTATAATCCATCCAAAAATGTCATACTTAAGATCACTGCTCTT
                      ____________________________________________________________
consensus AC-AATACCAACAGCAAGTATAATCCATCCAAAAATGTCATACTTAAGATCACTGCTCTT
 
. : . : . : . : . : . :
JMFN044H04+ CTTGTTCTTTGCAGTCTTTGTACTTGTAGATGTAGAAGGCCCTGGCCCCATTTGCCCCAT
rJMFF002P13- CTTGTTCTTTGCAGTCTTTGTACTTGTAGATGTAGAAGGCCCTGGCCCCATTTGCCCCAT
rJMFF019D16- CTTGTTCTTTGCAGTCTTTGTACTTGTAGATGTAGAAGGCCCTGGCCCCATTTGCCCCAT
rJMFF020O04- CTTGTTCTTTGCAGTCTTTGTACTTGTAGATGTAGAAGG-GCTGGCCCCATTTGCCCCAT
rJMSF024L06- CTTGTTCTTTGCAGTCTTTGTACTTGTAGATGTAGAAGGCCCTGGCCCCATTTGCCCCAT
rJMSF014B09- CTTGTTCTTTGCAGTCTTTGTACTTGTAGATGTAGAAGGCCCTGGCCCCATTTGCCCCAT
JMFN035O11+ CTTGTTCTTTGCAGTCTTTGTACTTGTAGATGTAGAAGGCCCTGGCCCCATTTGCCCCAT
JMFF019D16+ TGCAGTCTTTGTACTTGTAGATGTAGAAGGCCCTGGCCCCATTTGCCCCAT
JMSF024L06+ CTTGTTCTTTGCAGTCTTTGTACTTGTAGATGTAGAAGGCCCTGGCCCCATTTGCCCCAT
                      ____________________________________________________________
consensus CTTGTTCTTTGCAGTCTTTGTACTTGTAGATGTAGAAGGCCCTGGCCCCATTTGCCCCAT
 
. : . : . : . : . : . :
JMFN044H04+ AGCTTGTTGCATTGAACCATGCTTGTGGATCTCTGTGTGCAATTCAGGAGCCTTAGCAGC
rJMFF002P13- AGCTTGTTGCATTGAACCATGCTTGTGGATCTCTGTGTGCAATTCAGGAGCCTTAGCAGC
rJMFF019D16- AGCTTGTTGCATTGAACCATGCTTGTGGATCTCTGTGTGCAATTCAGGAGCCTTAGCAGC
rJMFF020O04- AGCTTGTTGCATTGAACCATGCTTGTGGATCTCTGTGTGCAATTCAGGAGCCTTAGCAGC
rJMSF024L06- AGCTTGTTGCATTGAACCATGCTTGTGGATCTCTGTGTGCAATTCAGGAGCCTTAGCAGC
rJMSF014B09- AGCTTGTTGCATTGAACCATGCTTGTGGATCTCTGTGTGCAATTCAGGAGCCTTAGCAGC
JMFN035O11+ AGCTTGTTGCATTGAACCATGCTTGTGGATCTCTGTGTGCAATTCAGGAGCCTTAGCAGC
JMFF019D16+ AGCTTGTTGCATTGAACCATGCTTGTGGATCTCTGTGTGCAATTCAGGAGCCTTAGCAGC
JMFF020O04+ TGTGTGCAATTCAGGAGCCTTAGCAGC
JMSF024L06+ AGCTTGTTGCATTGAACCATGCTTGTGGATCTCTGTGTGCAATTCAGGAGCCTTAGCAGC
                      ____________________________________________________________
consensus AGCTTGTTGCATTGAACCATGCTTGTGGATCTCTGTGTGCAATTCAGGAGCCTTAGCAGC
 
. : . : . : . : . : . :
JMFN044H04+ AACTTCCAAAGATTTGCGGTAAAGATCATTCGCTGGATCCGCTTCAACTGCACGCTCAAA
rJMFF002P13- AAATTCCAAAGATTTGCGGTAAAGATCATTCGCTGGATCCGCTTCAACTGCACGCTCAAA
rJMFF019D16- AACTTCCAAAGATTTGCGGTAAAGATCATTCGCTGGATCCGCTTCAACTGCACGCTCAAA
rJMFF020O04- AACTTCCAAAGATTTG-GGTAAAGATCATTCTCTGGATCCGCTTCAACTGCACGCTCAAA
rJMSF024L06- AACTTCCAAAGATTTGCGGTAAAGATCATTCGCTGGATCCGCTTCAACTGCACGCTCAAA
rJMSF014B09- AACTTCCAAAGATTTGCGGTAAAGATCATTCGCTGGATCCGCTTCAACTGCACGCTCAAA
JMFN035O11+ AACTTCCAAAGATTTGCGGTAAAGATCATTCGCTGGATCCGCTTCAACTGCACGCTCAAA
JMFF019D16+ AACTTCCAAAGATTTGCGGTAAAGATCATTCGCTGGATCCGCTTCAACTGCACGCTCAAA
JMFF020O04+ AACTTCCAAAGATTTG-GGTAAAGATCATTCTCTGGATCCGCTTCAACTGCACGCTCAAA
JMSF024L06+ AACTTCCAAAGATTTGCGGTAAAGATCATTCGCTGGATCCGCTTCAACTGCACGCTCAAA
                      ____________________________________________________________
consensus AACTTCCAAAGATTTGCGGTAAAGATCATTCGCTGGATCCGCTTCAACTGCACGCTCAAA
 
. : . : . : . : . : . :
JMFN044H04+ ACATAGGGTTGCTTTATCAAAATAAACCTTAGCTTCATCTTGATCAGGAGTCAA
rJMFF002P13- ACATAGGGTTGCTTTATCAAAATAAACCTTAGCTTCATCTTGATCAGGAGTCAAGAATGC
rJMFF019D16- ACATAGGGTTGCTTTATCAAAATAAACCTTAGCTTCATCTTGATCAGGAGTCAAGAATGC
rJMFF020O04- ACATAGGGTTGCTTTATCAAAATAAACCTTAGCTTCATCTTGATCAGGAGTCAAGAATGC
rJMSF024L06- ACATAGGGTTGCTTTATCAAAATAAACCTTAGCTTCATCTTGATCAGGAGTCAAGAATGC
rJMSF014B09- ACATAGGGTTGCTTTATCAAAATAAACCTTAGCTTCATCTTGATCAGGAGTCAAGAATGC
JMFN035O11+ ACATAGGGTTGCTTTATCAAAATAAACCTTAGCTTCATCTTGATCAGGAGTCAAGAATGC
JMFF019D16+ ACATAGGGTTGCTTTATCAAAATAAACCTTAGCTTCATCTTGATCAGGAGTCAAGAATGC
JMFF020O04+ ACATAGGGTTGCTTTATCAAAATAAACCTTAGCTTCATCTNGATCAGGAGTCAAGAATGC
JMSF024L06+ ACATAGGGTTGCTTTATCAAAATAAACCTTAGCTTCATCTTGATCAGGAGTCAAGAATGC
                      ____________________________________________________________
consensus ACATAGGGTTGCTTTATCAAAATAAACCTTAGCTTCATCTTGATCAGGAGTCAAGAATGC
 
. : . : . : . : . : . :
rJMFF002P13- ATGAGATGTATGTGCATTTCCCAGACACCAAACAGCATCATGTTTTT-GGGGATTGATGT
rJMFF019D16- ATGAGATGTATGTGCATTTCCCAGACACCAAACAGCATCATGTTTTT-GGGGATTGATGT
rJMFF020O04- ATGAGATGTATGTGCATTTCCCAGACACCAAACAGCATCATGTTTTTGGGGGATTGATGT
rJMSF024L06- ATGAGATGTATGTGCATTTCCCAGACACCAAACAGCATCATGTTTTT-GGGGATTGATGT
rJMSF014B09- ATGAGATGTATGTGCATTTCCCAGACACCAAACAGCATCATGTTTTT-GGGGATTGATGT
JMFN035O11+ ATGAGATGTATGTGCATTTCCCAGACACCAAACAGCATCATGTTTTT-GGGGATTGATGT
JMFF019D16+ ATGAGATGTATGTGCATTTCCCAGACACCAAACAGCATCATGTTTTT-GGGGATTGATGT
JMFF020O04+ ATGAGATGTATGTGCATTTCCCAGACACCAAACAGCATCATGTTTTT-GGGGATTGATGT
JMSF024L06+ ATGAGATGTATGTGCATTTCCCAGACACCAAACAGCATCATGTTTTT-GGGGATTGATGT
                      ____________________________________________________________
consensus ATGAGATGTATGTGCATTTCCCAGACACCAAACAGCATCATGTTTTT-GGGGATTGATGT
 
. : . : . : . : . : . :
rJMFF002P13- CTAATGCCTCCTCCAACTTTGAAATAGAGTCGAGAATCATCTGTTTGGATTCAGGAACAG
rJMFF019D16- CTAATGCCTCCTCCAACTTTGAAATAGAGTCGAGAATCATCTGTTTGGATTCAGGAACAG
rJMFF020O04- CTAATGCCTCCTCCAACTTTGAAATANAGTCGAGAATCATCTGTTTGGATTCANGAACAG
rJMSF024L06- CTAATGCCTCCTCCAACTTTGAAATAGAGTCGAGAATCATCTGTTTGGATTCAGGAACAG
rJMSF014B09- CTAATGCCTCCTCCAACTTTGAAATAGAGTCGAGAATCATCTGTTTGGATTCAGGAACAG
JMFN035O11+ CTAATGCCTCCTCCAACTTTGAAATAGAGTCGAGAATCATCTGTTTGGATTCAGGAACAG
JMFF019D16+ CTAATGCCTCCTCCAACTTTGAAATAGAGTCGAGAATCATCTGTTTGGATTCAGGAACAG
JMFF020O04+ NTAATGCCTCCTCCAACTNTGAAATAGAGTCGAGAATCATCTGTTTGGATTCAGGAACAG
JMSF024L06+ CTAATGCCTCCTCCAACTTTGAAATAGAGTCGAGAATCATCTGTTTGGATTCAGGAACAG
                      ____________________________________________________________
consensus CTAATGCCTCCTCCAACTTTGAAATAGAGTCGAGAATCATCTGTTTGGATTCAGGAACAG
 
. : . : . : . : . : . :
rJMFF002P13- GCT-GAAACTGTGACAACTCAAGTAACGCACCGCCCCATCTCGTCAA
rJMFF019D16- GCT-GAAACTGTGACAACTCAAGTAACGCACCGCCCCATCTCGTCAAGTTATCGGCGTCA
rJMFF020O04- GCTGGAAACTGTGACAACTCAAGTAACGCACCGCCCCATCTCGTCAAGTTATCGGCGTCA
rJMSF024L06- GCT-GAAACTGTGACAACTCAAGTAACGCACCGCCCCATCTCGTCAAGTTATCGGCGTCA
rJMSF014B09- GCT-GAAACTGTGACAACTCAAGTAACGCACCGCCCCATCTCGTCAAGTTATCGGCGTCA
JMFN035O11+ GCT-GAAACTGTGACAACTCAAGTAACGCACCGCCCCATCTCGTCAAGTTATCGGCGTCA
JMFF019D16+ GCT-GAAACTGTGACAACTCAAGTAACGCACCGCCCCATCTCGTCAAGTTATCGGCGTCA
JMFF020O04+ GCT-GAAACTGTGACAACTCAAGTAACGCACCGCCCCATCTCGTCAAGTTATCGGCGTCA
JMSF024L06+ GCT-GAAACTGTGACAACTCAAGTAACGCACCGCCCCATCTCGTCAAGTTATCGGCGTCA
JMSF014B09+ T-GAAACTGTGACAACTCAAGTAACGCACCGCCCCATCTCGTCAAGTTATNGGCGTCA
                      ____________________________________________________________
consensus GCT-GAAACTGTGACAACTCAAGTAACGCACCGCCCCATCTCGTCAAGTTATCGGCGTCA
 
. : . : . : . : . : . :
rJMFF019D16- AGGGGATTCTTCTCGT
rJMFF020O04- AGGGGATTCTTCTCGTAAGCGGCTTC
rJMSF024L06- AGGGGATTCTTCTCGTAGGCGGCTTCNGCAGTCTTGCG
rJMSF014B09- AGGGGATTCTTCTCGTAGGCGGCTTCGGCAGTCTTGCGAGCGTGCTCGAA
JMFN035O11+ AGGGGATTCTTCTCGTAGGCGGCTTCGGCAGTCTTGCGAGCGTGCTCGAAGAAGAGAAGG
JMFF019D16+ AGGGGATTCTTCTCGTAGGCGGCTTCGGCAGTCTTGCGAGCGTGCTCGAAGAAGAGAAGG
JMFF020O04+ AGGGGATTCTTCTCGTAGGCGGCTTCGGCAGTCTTGCGAGCGTGCTCGAAGAAGAGAAGG
JMSF024L06+ AGGGGATTCTTCTCGTAGGCGGCTTCGGCAGTCTTGCGAGCGTGCTCGAAGAAGAGAAGG
JMSF014B09+ AGGGGATTCTTCTCGTAGGCGGCTTCGGCAGTCTTGCGAGCGTGCTCGAAGAAGAGAAGG
                      ____________________________________________________________
consensus AGGGGATTCTTCTCGTAGGCGGCTTCGGCAGTCTTGCGAGCGTGCTCGAAGAAGAGAAGG
 
. : . : . : . : . : . :
JMFN035O11+ CGATCGAATTCGCTTGACATCTCCATCCTTAGTC
JMFF019D16+ CGATCGAATTCGCTTGACATCTCCATCCTTAGTCCTTACTCACCACCGATCAAACAAATT
JMFF020O04+ CGATCGAATTCGCTTGACATCTCCATCCTTAGTCCCTACTCACCACCGATCAAACAAATT
JMSF024L06+ CGATCGAATTCGCTTGACATCTCCATCCTTAGTCCTTACTCACCACCGATCAAACAAATT
JMSF014B09+ CGATCGAATTCGCTTGACATCTCCATCCTTAGTCCTTACTCACCACCGATCAAACAAATT
                      ____________________________________________________________
consensus CGATCGAATTCGCTTGACATCTCCATCCTTAGTCCTTACTCACCACCGATCAAACAAATT
 
. : . : . : . : . : . :
JMFF019D16+ CTTCGCTCCTTTGCAGGCTAGGGCTTCTGCTTCTTACTACT
JMFF020O04+ CTTCGCTCCTTTGCAGGCTAGGGCTTCTGCTTCTTACTACTGTTGTCC
JMSF024L06+ CTTCGCTCCTTTGCAGGCTAGGGCTTCTGCTTCTTACTACTGTTGTCC
JMSF014B09+ CTTCGCTCCTTTGCAGGCTAGGGCTTCTGCTTCTTACTACTGTTGTCCAGCTGGGCGGCA
                      ____________________________________________________________
consensus CTTCGCTCCTTTGCAGGCTAGGGCTTCTGCTTCTTACTACTGTTGTCCAGCTGGGCGGCA