Previous Contig 005438:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS005E04Sequence572005438 (6)gb:AP002053_18216982e-30Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T13O13.
JMFS050E03Sequence612005438 (6)gb:AP002053_18216987e-47Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T13O13.
JMFS101F07Sequence623005438 (6)gb:AP002053_18216986e-31Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T13O13.
JMSF008D07Sequence284005438 (6)773011765 (4)
JMSF013P06Sequence439005438 (6)gb:AP002053_18216987e-13Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T13O13.705011765 (4)
JMSF018A18Sequence233005438 (6)774011765 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS050E03+ GGTAACTTCGACCTTNTGTCCTGTATCTGCTTTAATACCATAAACTTTTACTTTAGCTCC
                      ____________________________________________________________
consensus GGTAACTTCGACCTTNTGTCCTGTATCTGCTTTAATACCATAAACTTTTACTTTAGCTCC
 
. : . : . : . : . : . :
JMFS050E03+ AGTTTCCTTTTCCAGTCGTTTATGAGTGTCACTCACATGTCCAAAGATCAAGCCAATGAA
                      ____________________________________________________________
consensus AGTTTCCTTTTCCAGTCGTTTATGAGTGTCACTCACATGTCCAAAGATCAAGCCAATGAA
 
. : . : . : . : . : . :
JMFS050E03+ ATTGTACCCAGGATGCTCTTTGATAGGGATAGGAACTTTTCCTTCTTTCTGGATAGGTTT
JMFS005E04+ AGGATGCTCTTTGATAGGGATAGGAACTTTTCCTTCTTTCTGGATAGGTTT
JMFS101F07+ CTGGATAGGTTT
                      ____________________________________________________________
consensus ATTGTACCCAGGATGCTCTTTGATAGGGATAGGAACTTTTCCTTCTTTCTGGATAGGTTT
 
. : . : . : . : . : . :
JMFS050E03+ GTAGCCAGCAGGTGGCTTATAGTTAGGATTTAGTTTTAGAACTTCACCAATGGCTTCTCG
JMFS005E04+ GTAGCCAGCAGGTGGCTTATAGTTAGGATTTAGTTTTAGAACTTCACCAATGGCTTCTCG
JMFS101F07+ GTAGCCAGCAGGTGGCTTATAGTTAGGATTTAGTTTTAGAACTTCACCAATGGCTTCTCG
                      ____________________________________________________________
consensus GTAGCCAGCAGGTGGCTTATAGTTAGGATTTAGTTTTAGAACTTCACCAATGGCTTCTCG
 
. : . : . : . : . : . :
JMFS050E03+ CTTTTCAAGTTCCAATGATTTTATTTTCTCAGCATCAAGTTTATAATCCAGAATACTAGA
JMFS005E04+ CTTTTCAAGTTCCAATGATTTTATTTTCTCAGCATCAAGTTTATAATCCAGAATACTAGA
JMFS101F07+ CTTTTCAAGTTCCAATGATTTTATTTTCTCAGCATCAAGTTTATAATCCAGAATACTAGA
                      ____________________________________________________________
consensus CTTTTCAAGTTCCAATGATTTTATTTTCTCAGCATCAAGTTTATAATCCAGAATACTAGA
 
. : . : . : . : . : . :
JMFS050E03+ GGCTGTTAATCTGTCTTGGTTCTCTTCCCAGTCCATAGGTCCTGAACTCAGCTGTTGTGC
JMFS005E04+ GGCTGTTAATCTGTCTTGGTTCTCTTCCCAGTCCATAGGTCCTGAACTCAGCTGTTGTGC
JMFS101F07+ GGCTGTTAATGTGTCTTGGTTCTCTTCCCAGTCCATAGGTCCTGAACTCAGCTGTTGTGC
                      ____________________________________________________________
consensus GGCTGTTAATCTGTCTTGGTTCTCTTCCCAGTCCATAGGTCCTGAACTCAGCTGTTGTGC
 
. : . : . : . : . : . :
JMFS050E03+ TATTTGATCAACACGAGTCTGATATGCTAAGGCTCTTCCTTTCCTAACAGTTGTATCTTG
JMFS005E04+ TATTTGATCAACACGAGTCTGATATGCTAAGGCTCTTCCTTTCCTAACAGTTGTATCTTG
JMFS101F07+ TATTTGATCAACACGAGTCTGATATGCTAAGGCTCTTCCTTTCCTAACAGTTGTATCTTG
JMSF013P06+ TCCTAACAGTTGTATCTTG
                      ____________________________________________________________
consensus TATTTGATCAACACGAGTCTGATATGCTAAGGCTCTTCCTTTCCTAACAGTTGTATCTTG
 
. : . : . : . : . : . :
JMFS050E03+ TGTCAGATCAGGGCCCCACTTAGTTTTCCTCCGCACCAGTTTAGTGCTTTCTTCATTTAC
JMFS005E04+ TGTCAGATCAGGGCCCCACTTAGTTTTCCTCCGCACCAGTTTAGTGCTTTCTTCATTTAC
JMFS101F07+ TGTCAGATCAGGGCCCCACTTAGTTTTCCTCCGCACCAGTTTAGTGCTTTCTTCATTTAC
JMSF013P06+ TGTCAGATCAGGGCCCCACTTAGTTTTCCTCCGCACCAGTTTAGTGCTTTCTTCATTTAC
                      ____________________________________________________________
consensus TGTCAGATCAGGGCCCCACTTAGTTTTCCTCCGCACCAGTTTAGTGCTTTCTTCATTTAC
 
. : . : . : . : . : . :
JMFS050E03+ TGACTCACTACCCTCCTTTTTACCTCCTCGAAGGACAGGAACCATAGAACCTGACAACTT
JMFS005E04+ TGACTCACTACCCTCC-TTTTACCTCCTCGAAGGACAGGAACCATAGAACCTGACAACTT
JMFS101F07+ TGACTCACTACCCTCCTTTTTACCTCCTCGAAGGACAGGAACCATAGAACCTGACAACTT
JMSF013P06+ TGACTCACTACCCTCCTTTTTACCTCCTCGAAGGACAGGAACCATAGAACCTGACAACTT
                      ____________________________________________________________
consensus TGACTCACTACCCTCCTTTTTACCTCCTCGAAGGACAGGAACCATAGAACCTGACAACTT
 
. : . : . : . : . : . :
JMFS050E03+ GTTCTTTGGTATCACAAACCCAGATTTGTTGGCAAAGATGGAGATCTTTGCAGCACTTGT
JMFS005E04+ GTTCTTTGGTATCACAAACCCAGATTTGTTGGCAAAGATGGAGATCTTTGCAGCACTTGT
JMFS101F07+ GTTCTTTGGTATCACAAACCCAGATTTGTTGGCAAAGATGGAGATCTTTGCAGCACTTGT
JMSF008D07+ AAACCCAGATTTGTTGGCAAAGATGGAGATCTTTGCAGCACTTGT
JMSF013P06+ GTTCTTTGGTATCACAAACCCAGATTTGTTGGCAAAGATGGAGATCTTTGCAGCACTTGT
                      ____________________________________________________________
consensus GTTCTTTGGTATCACAAACCCAGATTTGTTGGCAAAGATGGAGATCTTTGCAGCACTTGT
 
. : . : . : . : . : . :
JMFS050E03+ TGTTGGAGCCAT
JMFS005E04+ TGTTGGAGCCATTGTAGTGCTCTGCATATTGTGAGATGCTTCCCCAATTTTTATGCTCAT
JMFS101F07+ TGTTGGAGCCATTGTAGTGCTCTGCATATTGTGAGATGCTTCCCCAATTTTTATGCTCAT
JMSF018A18+ AGCCATTGTAGTGCTCTGCATATTGTGAGATGCTTCCCCAATTTTTATGCTCAT
JMSF008D07+ TGTNGGAGCCATTGTAGTGCTCTGCATATTGTGAGATGCTTCCCCAATTTTTATGCTCAT
JMSF013P06+ TGTTGGAGCCATTGTAGTGCTCTGCATATTGTGAGATGCTTCCCCAATTTTTATGCTCAT
                      ____________________________________________________________
consensus TGTTGGAGCCATTGTAGTGCTCTGCATATTGTGAGATGCTTCCCCAATTTTTATGCTCAT
 
. : . : . : . : . : . :
JMFS005E04+ CTCAACCTTCAAGTAAACTCCACCACTTGCTAAAAAATATGA
JMFS101F07+ CTCAACCTTCAAGTAAACTCCACCACTTGCTAAAAAATATGAAATCCTGTATGGAAAAAG
JMSF018A18+ CTCAACCTTCAAGTAAACTCCACCACTTGCTAAAAAATATGAAATCCTGTATGGAAAAAG
JMSF008D07+ CTCAACCTTCAAGTAAACTCCACCACTTGCTAAAAAATATGAAATCCTGTATGGAAAAAG
JMSF013P06+ CTCAACCTTCAAGTAAACTCCACCACTTGCTAAAAAATATGAAATCCTGTATGGAAAAAG
                      ____________________________________________________________
consensus CTCAACCTTCAAGTAAACTCCACCACTTGCTAAAAAATATGAAATCCTGTATGGAAAAAG
 
. : . : . : . : . : . :
JMFS101F07+ TTGAGCAGTGTCTGTGTTTTACATTAACTGAATTTTTGGAATGGGGGAGGAATTGGCGAG
JMSF018A18+ TTGAGCAGTGTCTGTGTTTTACATTAACTGAATTTTTGGAATGGGGGAGGAATTGGCGAG
JMSF008D07+ TTGAGCAGTGTCTGTGTTTTACATTAACTGAATTTTTGGAATGGGGGAGGAATTGGCGAG
JMSF013P06+ TTGAGCAGTGTCTGTGTTTTACATTAACTGAATTTTTGGAATGGGGGAGGAATTGGCGAG
                      ____________________________________________________________
consensus TTGAGCAGTGTCTGTGTTTTACATTAACTGAATTTTTGGAATGGGGGAGGAATTGGCGAG
 
. : . : . : . : . : . :
JMFS101F07+ AGCGCTTTGAG
JMSF018A18+ AGCGCTTTGAGGGATCCGGAGCCCGGAGAAGAAGAAATGAGGGGGGTACTACTCGCCCC
JMSF008D07+ AGCGCTTTGAGGGATCCGGAGCCCGGAGAAGAAGAAATGAGGGGGGTACTACTCGCCCC
JMSF013P06+ AGCGCTTTGAGGGATCCGGAGCCCGGAGAAGAAGAAATGAGGGGGGTACTACTCGCCCCC
                      ____________________________________________________________
consensus AGCGCTTTGAGGGATCCGGAGCCCGGAGAAGAAGAAATGAGGGGGGTACTACTCGCCCCC