Previous Contig 005437:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS111A04Sequence618005437 (5)gb:BT012227_16414331e-27Arabidopsis thaliana At3g53760 gene, complete cds.>gb:BT012412_1641563 Arabidops
JMSF013O14Sequence482005437 (5)148022576
JMSF020H18Sequence627005437 (5)gb:BT012227_16414333e-26Arabidopsis thaliana At3g53760 gene, complete cds.>gb:BT012412_1641563 Arabidops
JMSF022K04Sequence678005437 (5)gb:BT012227_16414333e-32Arabidopsis thaliana At3g53760 gene, complete cds.>gb:BT012412_1641563 Arabidops766012266 (2)gb:BT012227_16414335e-84Arabidopsis thaliana At3g53760 gene, complete cds.>gb:BT012412_1641563 Arabidops
JMSF048H23Sequence647005437 (5)gb:BT012227_16414331e-27Arabidopsis thaliana At3g53760 gene, complete cds.>gb:BT012412_1641563 Arabidops722012266 (2)gb:BT012227_16414338e-76Arabidopsis thaliana At3g53760 gene, complete cds.>gb:BT012412_1641563 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022K04+ CA
                      ____________________________________________________________
consensus CA
 
. : . : . : . : . : . :
JMFS111A04+ TCTTTTTTCCCTTTTGACAGT
JMSF022K04+ ATTCCATNGGCAATGGCTCTCCNGTATACACTCTGTTTCTCTTTTTTCCCTTTTGACAGT
JMSF048H23+ TCTTTTTTCCCTTTTGACAGT
JMSF020H18+ AGT
                      ____________________________________________________________
consensus ATTCCATNGGCAATGGCTCTCCNGTATACACTCTGTTTCTCTTTTTTCCCTTTTGACAGT
 
. : . : . : . : . : . :
JMFS111A04+ TCAGAAGCTCTAGCCAATGGTGATTCATTGCTGGACCTAATCCAGCTCAAATTACGTGAC
JMSF022K04+ TCAGAAGCTCTAGCCAATGGTGATTCATTGCTGGACCTAATCCAGCTCAAATTACGTGAC
JMSF048H23+ TCAGAAGCTCTAGCCAATGGTGATTCATTGCTGGACNTAATCCAGCTCAAATTACGTGAC
JMSF020H18+ TCAGAAGCTCTAGCCAATGGTGATTCATTGCTGGACCTAATCCAGCTCAAATTACGTGAC
                      ____________________________________________________________
consensus TCAGAAGCTCTAGCCAATGGTGATTCATTGCTGGACCTAATCCAGCTCAAATTACGTGAC
 
. : . : . : . : . : . :
JMFS111A04+ TTAGTTGCAAACCTATCAAGCTCCCGGTAATAAAAACCTAGTGCAATTATCTTCTCAATT
JMSF022K04+ TTAGTTGCAAACCTATCAAGCTCCCGGTAATAAAAACCTAGTGCAATTATCTTCTCAATT
JMSF048H23+ TTAGTTGCAAACCTATCAAGCTCCCGGTAATAAAAACCTAGTGCAATTATCTTCTCAATT
JMSF020H18+ TTAGTTGCAAACCTATCAAGCTCCCGGTAATAAAAACCTAGTGCAATTATCTTCTCAATT
                      ____________________________________________________________
consensus TTAGTTGCAAACCTATCAAGCTCCCGGTAATAAAAACCTAGTGCAATTATCTTCTCAATT
 
. : . : . : . : . : . :
JMFS111A04+ ACATCCCTTTCACTGGGTTGGATGAAGGAGAGATCAGGAGCGAGTACAAAGGTAGGCTCT
JMSF022K04+ ACATCCCTTTCACTGGGTTGGATGAAGGAGAGATCAGGAGCGAGTACAAAGGTAGGCTCT
JMSF048H23+ ACATCCCTTTCACTGGGTTGGATGAAGGAGAGATCAGGAGCGAGTACAAAGGTAGGCTCT
JMSF020H18+ ACATCCCTTTCACTGGGTTGGATGAAGGAGAGATCAGGAGCGAGTACAAAGGTAGGCTCT
JMSF013O14+ CT
                      ____________________________________________________________
consensus ACATCCCTTTCACTGGGTTGGATGAAGGAGAGATCAGGAGCGAGTACAAAGGTAGGCTCT
 
. : . : . : . : . : . :
JMFS111A04+ TCAGCAATTGGCGTGTCAGGGGACAACTGAACACGGAGTGATTGCTGGTGCTCTCTTTTA
JMSF022K04+ TCAGCAATTGGCGTGTCAGGGGACAACTGAACACGGAGTGATTGCTGGTGCTCTCTTTTA
JMSF048H23+ TCAGCAATTGGCGTGTCAGGGGACAACTGAACACGGAGTGATTGCTGGTGCTCTCTTTTA
JMSF020H18+ TCAGCAATTGGCGTGTCAGGGGACAACTGAACACGGAGTGATTGCTGGTGCTCTCTTTTA
JMSF013O14+ TCAGCAATNGGCGTGTCAGGGGACAACTGAACACGGAGTGATTGCTGGTGCTCTCTTTTA
                      ____________________________________________________________
consensus TCAGCAATTGGCGTGTCAGGGGACAACTGAACACGGAGTGATTGCTGGTGCTCTCTTTTA
 
. : . : . : . : . : . :
JMFS111A04+ TCAATGATGAGATCTCCAGTATAACCTAATAGGGCCAATAAGAGTTCGTGCAGCATTGTG
JMSF022K04+ TCAATGATGAGATCTCCAGTATAACCTAATAGGGCCAATAAGAGTTCGTGCAGCATTGTG
JMSF048H23+ TCAATGATGAGATCTCCAGTATAACCTAATAGGGCCAATAAGAGTTCGTGCAGCATTGTG
JMSF020H18+ TCAATGATGAGATCTCCAGTATAACCTAATAGGGCCAATAAGAGTTCGTGCAGCATTGTG
JMSF013O14+ TCAATGATGAGATCTCCAGTATAACCTAATAGGGCCAATAAGAGTTCGTGCAGCATTGTG
                      ____________________________________________________________
consensus TCAATGATGAGATCTCCAGTATAACCTAATAGGGCCAATAAGAGTTCGTGCAGCATTGTG
 
. : . : . : . : . : . :
JMFS111A04+ CTAGACTTCCAACAGTCTTCTTTCTGCAGTGTCTCACTCACCCCAGTACTTCACATACAC
JMSF022K04+ CTAGACTTCCAACAGTCTTCTTTCTGCAGTGTCTCACTCACCCCAGTACTTCACATACAC
JMSF048H23+ CTAGACTTCCAACAGTCTTCTTTCTGCAGTGTCTCACTCACCCCAGTACTTCACATACAC
JMSF020H18+ CTAGACTTCCAACAGTCTTCTTTCTGCAGTGTCTCACTCACCCCAGTACTTCACATACAC
JMSF013O14+ CTAGACTTCCAACAGTCTTCTTTCTGCAGTGTCTCACTCACCCCAGTACTTCACATACAC
                      ____________________________________________________________
consensus CTAGACTTCCAACAGTCTTCTTTCTGCAGTGTCTCACTCACCCCAGTACTTCACATACAC
 
. : . : . : . : . : . :
JMFS111A04+ AACCGGGGTGCAATTTTTCCAGCTCCATCGTCAAATTTGAACTTCTAAGTGCCCAGATTT
JMSF022K04+ AACCGGGGTGCAATTTTTCCAGCTCCATCGTCAAATTTGAACTTCTAAGTGCCCAGATTT
JMSF048H23+ AACCGGGGTGCAATTTTTCCAGCTCCATCGTCAAATTTGAACTTCTAAGTGCCCAGATTT
JMSF020H18+ AACCGGGGTGCAATTTTTCCAGCTCCATCGTCAAATTTGAACTTCTAAGTGCCCAGATTT
JMSF013O14+ AACCGGGGTGCAATTTTTCCAGCTCCATCGTCAAATTTGAACTTCTAAGTGCCCAGATTT
                      ____________________________________________________________
consensus AACCGGGGTGCAATTTTTCCAGCTCCATCGTCAAATTTGAACTTCTAAGTGCCCAGATTT
 
. : . : . : . : . : . :
JMFS111A04+ GAGTGAATTCCCAAAAGGTTTTCATACCATGGTGGGCAGCGGTCTCAGCCCGCGTACGGC
JMSF022K04+ GAGTGAATTCCCAAAAGGTTTTCATACCATGGTGGGCAGCGGTCTCAGCCCGCGTACGGC
JMSF048H23+ GAGTGAATTCCCAAAAGGTTTTCATACCATGGTGGGCAGCGGTCTCAGCCCGCGTACGGC
JMSF020H18+ GAGTGAATTCCCAAAAGGTTTTCATACCATGGTGGGCAGCGGTCTCAGCCCGCGTACGGC
JMSF013O14+ GAGTGAATTCCCAAAAGGTTTTCATACCATGGTGGGCAGCGGTCTCAGCCCGCGTACGGC
                      ____________________________________________________________
consensus GAGTGAATTCCCAAAAGGTTTTCATACCATGGTGGGCAGCGGTCTCAGCCCGCGTACGGC
 
. : . : . : . : . : . :
JMFS111A04+ GAACGAGCTGCTGAGTTCTGACTCACTCACTGATTCGCTGCCTGCTTGCTAAAGGTCCTT
JMSF022K04+ GAACGAGCTGCTGAGTTCTGACTCACTCACTGATTCGCTGCCTGCTTGCTAAAGGTCCTT
JMSF048H23+ GAACGAGCTGCTGAGTTCTGACTCACTCACTGATTCGCTGCCTGCTTGCTAAAGGTCCTT
JMSF020H18+ GAACGAGCTGCTGAGTTCTGACTCACTCACTGATTCGCTGCCTGCTTGCTAAAGGTCCTT
JMSF013O14+ GAACGAGCTGCTGAGTTCTGACTCACTCACTGATTCGCTGCCTGCTTGCTAAAGGTCCTT
                      ____________________________________________________________
consensus GAACGAGCTGCTGAGTTCTGACTCACTCACTGATTCGCTGCCTGCTTGCTAAAGGTCCTT
 
. : . : . : . : . : . :
JMFS111A04+ CACTGTGAAGTCTGAAGTGGTAGAATTGCAGAAGGCGAAGCACTGAAGGTCTGAAGG
JMSF022K04+ CACTGTGAAGTCTGAAGTGGTAGAATTGCAGAAGGCGAAGCACTGAAGGTCTGAAGGCTG
JMSF048H23+ CACTGTGAAGTCTGAAGTGGTAGAATTGCAGAAGGCGAAGCACTGAAGGTCTGAAGGCTG
JMSF020H18+ CACTGTGAAGTCTGAAGTGGTAGAATTGCAGAAGGCGAAGCACTGAAGGTCTGAAGGCTG
JMSF013O14+ CACTGTGAAGTCTGAAGTGGTAGAATTGCAGAAGGCGAAGCACTGAAGGTCTGAAGGCTG
                      ____________________________________________________________
consensus CACTGTGAAGTCTGAAGTGGTAGAATTGCAGAAGGCGAAGCACTGAAGGTCTGAAGGCTG
 
. : . : . : . : . : . :
JMSF022K04+ AAGCGGTGGCGGTC
JMSF048H23+ AAGCGGTGGCGGTCTGAAACTT
JMSF020H18+ AAGCGGTGGCGGTCTGAAACTT
JMSF013O14+ AAGCGGTGGCGGTCTGAAACTTTAATCGAGGGTGAGGGAGAAGAGCTGAGTTTTATTTTC
                      ____________________________________________________________
consensus AAGCGGTGGCGGTCTGAAACTTTAATCGAGGGTGAGGGAGAAGAGCTGAGTTTTATTTTC