Previous Contig 005431:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS046G01Sequence584005431 (5)gb:AY099702_15767275e-37Arabidopsis thaliana putative protein (At3g63460) mRNA, complete cds.>gb:BT00843
JMFS141F09Sequence621005431 (5)gb:AY099702_15767277e-42Arabidopsis thaliana putative protein (At3g63460) mRNA, complete cds.>gb:BT00843
JMSF009H22Sequence300005431 (5)gb:AY099702_15767271e-11Arabidopsis thaliana putative protein (At3g63460) mRNA, complete cds.>gb:BT00843698012662 (4)gb:AY099702_15767279e-47Arabidopsis thaliana putative protein (At3g63460) mRNA, complete cds.>gb:BT00843
JMSF013N01Sequence172005431 (5)718022569gb:AY099702_15767273e-49Arabidopsis thaliana putative protein (At3g63460) mRNA, complete cds.>gb:BT00843
JMSF030E09Sequence672005431 (5)gb:AY099702_15767271e-44Arabidopsis thaliana putative protein (At3g63460) mRNA, complete cds.>gb:BT00843747012662 (4)gb:AY099702_15767271e-49Arabidopsis thaliana putative protein (At3g63460) mRNA, complete cds.>gb:BT00843

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030E09+ TATCCCATATGC
                      ____________________________________________________________
consensus TATCCCATATGC
 
. : . : . : . : . : . :
JMFS046G01+ TTTGCTTTCATCAGCACCAGAAGCAAGGAGATTTGAAGTAAATACATT-AACTCCAA
JMSF030E09+ AAATTTGCCTTCATCAGCACCAGAAGCAAGGAGATTTGAAGTAAATACATTAAACTCCAA
                      ____________________________________________________________
consensus AAATTTGCTTTCATCAGCACCAGAAGCAAGGAGATTTGAAGTAAATACATTAAACTCCAA
 
. : . : . : . : . : . :
JMFS046G01+ TCCACGAACAGGCCCACTATGGTTAGAAAGATGGCCAACAAATGCATTTTCAGAGGCTTC
JMSF030E09+ ACCACGAACAGGCCCACTATGGTTAGAAAGATGGCCAACAAATGCATTTTCAGAGGCTTC
                      ____________________________________________________________
consensus TCCACGAACAGGCCCACTATGGTTAGAAAGATGGCCAACAAATGCATTTTCAGAGGCTTC
 
. : . : . : . : . : . :
JMFS046G01+ AGGACCTTCTCGACTTTTGCCAGAGGAGATCAAACGCCTGGGATTCCACAGCTCAATGGT
JMSF030E09+ AGGACCTTCTCGACTTTTGCCAGAGGAGATCAAACGCCTGGGATTCCACAGCCCAATGGT
                      ____________________________________________________________
consensus AGGACCTTCTCGACTTTTGCCAGAGGAGATCAAACGCCTGGGATTCCACAGCTCAATGGT
 
. : . : . : . : . : . :
JMFS046G01+ GCCATCAACAAGACCACCGTCGATGAGGCCGAGATAGAATTCTTCGGAATTGGGCAGAGC
JMSF030E09+ GCCATCAACAAGACCACCGGCGATGAGGCCGAGAGAGAATTCTTCGGAATTGGGCAGAGC
                      ____________________________________________________________
consensus GCCATCAACAAGACCACCGTCGATGAGGCCGAGATAGAATTCTTCGGAATTGGGCAGAGC
 
. : . : . : . : . : . :
JMFS046G01+ CTTCCCCCATGACAAGCGGTTGAACCGCTCGGAGCTTGCCACCGAGCCGGCCAAGATGAG
JMSF009H22+ GCTCGGAGCTTGCCACCGAGCCGGCCAAGATGAG
JMFS141F09+ AACCGCTCGGAGCTTGCCACCGAGCCGGCCAAGATGAG
JMSF030E09+ CTTCCCCCATGACAAGCGGTTGAACCGCTCGGAGCTTGCCACCGAGCCGGCCAAGATGAG
                      ____________________________________________________________
consensus CTTCCCCCATGACAAGCGGTTGAACCGCTCGGAGCTTGCCACCGAGCCGGCCAAGATGAG
 
. : . : . : . : . : . :
JMFS046G01+ CTCCCGATCATCTGATGTGAAGTCGAGCTCGAAGATGTCGAGATTGGCCGTGGAACTGAA
JMSF009H22+ CTCCCGATCATCTGATGTGAAGTCGAGCTCGAAGATGTCGAGATTGGCCGTGGAACTGAA
JMFS141F09+ CTCCCGATCATCTGATGTGAAGTCGAGCTCGAAGATGTCGAGATTGGCCGTGGAACTGAA
JMSF030E09+ CTCCCGATCATCTGATGTGAAGTCGAGCTCGAAGATGTCGAGATTGGCCGTGGAACTGAA
                      ____________________________________________________________
consensus CTCCCGATCATCTGATGTGAAGTCGAGCTCGAAGATGTCGAGATTGGCCGTGGAACTGAA
 
. : . : . : . : . : . :
JMFS046G01+ TGACAGATCGACCGCACCCGCCATGGTCCCGGCCGCTAGGTACGGCGCGTCGGGCGCGAA
JMSF009H22+ TGACAGATCGACCGCACCCGCCATGGTCCCGGCCGCGAGGTACGGCGCGTCGGGCGCGAA
JMFS141F09+ TGACAGATCGACCGCACCCGCCATGGTCCCGGCCGCGAGGTACGGCGCGTCGGGCGCGAA
JMSF030E09+ TGACAGATCGACCGCACCCGCCATGGTCCCGGCCGCGAGGTACGGCGCGTCGGGCGCGAA
                      ____________________________________________________________
consensus TGACAGATCGACCGCACCCGCCATGGTCCCGGCCGCGAGGTACGGCGCGTCGGGCGCGAA
 
. : . : . : . : . : . :
JMFS046G01+ CGCCGCTGACGCCGATCTGTTCTCCGCCTTCACAATCGCCATGGCTCACCGATCAATCCA
JMSF009H22+ CGCCGCCGACGCCGATCTGTTCACCGCCTTCACAATCGCCATGGCTCACCGATCAATCCA
JMFS141F09+ CGCCGCCGACGCCGATCTGTTCACCGCCTTCACAATCGCCATGGCTCACCGATCAATCCA
JMSF030E09+ CGCCGCCGACGCCGATCTGTTCACCGCCTTCACAATCGCCATGGCTCACCGATCAATCCA
                      ____________________________________________________________
consensus CGCCGCCGACGCCGATCTGTTCACCGCCTTCACAATCGCCATGGCTCACCGATCAATCCA
 
. : . : . : . : . : . :
JMFS046G01+ ACATCGAAGGTGTCATCCCTTGTGTTTGTAGAGATTGCGAAATGGATATAGGGTTGGGTT
JMSF009H22+ ACAACGAAGGCGTCCTCCCTTGTGTTTGTAGAGATTGCGAAATGGATCTAGGGTTGGGTT
JMFS141F09+ ACAACGAAGGCGTCCTCCCTTGTGTTTGTAGAGATTGCGAAATGGATCTAGGGTTGGGTT
JMSF030E09+ ACAACGAAGGCGTCCTCCCTTGTGTTTGTAGAGATTGCGAAATGGATCTAGGGTTGGGTT
JMSF013N01+ TCCCTTGTGTTTGTAGAGATTGCGAAATGGATCTAGGGTTGGGTT
                      ____________________________________________________________
consensus ACAACGAAGGCGTCCTCCCTTGTGTTTGTAGAGATTGCGAAATGGATCTAGGGTTGGGTT
 
. : . : . : . : . : . :
JMFS046G01+ TGAGAAATGGGGGAGAATTCACAGTGCGGGACAACAGATCGAGAGC
JMSF009H22+ TGAGAATTGGGGGAGAATTCACAG
JMFS141F09+ TGAGAATTGGGGGAGAATTCACAGTGCGGGACAACAGATCGAGAGCGTGTGTTATTGAAT
JMSF030E09+ TGAGAATTGGGGGAGAATTCACAGTGCGGGACAACAGATCGAGAGCGTGTGTTATTGAAT
JMSF013N01+ TGAGAATTGGGGGAGAATTCACAGTGCGGGACAACAGATCGAGAGCGTGTGTTATTGAAT
                      ____________________________________________________________
consensus TGAGAATTGGGGGAGAATTCACAGTGCGGGACAACAGATCGAGAGCGTGTGTTATTGAAT
 
. : . : . : . : . : . :
JMFS141F09+ TGTTTGGTTACGAATCGGAACTTTTTTAGTGTTCATTCAT
JMSF030E09+ TGTTTGGTTACGAATCGGAACTTTTTTAGTGTTCATTCATTCTTTCCTTCTGTTACTTCC
JMSF013N01+ TGTTTGGTTACGAATCGGAACTTTTTTAGTGNTCATTCATTCTTTCCTTCTGTTACTTCC
                      ____________________________________________________________
consensus TGTTTGGTTACGAATCGGAACTTTTTTAGTGTTCATTCATTCTTTCCTTCTGTTACTTCC