Previous Contig 005425:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004H19Sequence355005425 (2)gb:AP003022_18243062e-30Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P068
JMSF013M13Sequence270005425 (2)gb:AP003022_18243061e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P068656011757 (2)gb:ATAC021640_15437222e-48Arabidopsis thaliana chromosome III BAC F16B3 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF004H19+ CTGAGAAGATCTGCTAGGTGCCATTGGCTCAACCACCAGATCTGGATCAATGTGTCGCTG
                      ____________________________________________________________
consensus CTGAGAAGATCTGCTAGGTGCCATTGGCTCAACCACCAGATCTGGATCAATGTGTCGCTG
 
. : . : . : . : . : . :
JMSF004H19+ GTAGAACTTGCGCTTATAGTGGTCGACGACGTCGGAGCGGGAGGCCATGTGTGGTGGGAT
JMSF013M13+ GTCGGAGCGGGAGGCCATGTGTGGTGGGAT
                      ____________________________________________________________
consensus GTAGAACTTGCGCTTATAGTGGTCGACGACGTCGGAGCGGGAGGCCATGTGTGGTGGGAT
 
. : . : . : . : . : . :
JMSF004H19+ GAGAATATTGGACCAGTAATCGGCCCATTTGGGATCGTTCTCGTAGTCGTACGCCGCCGC
JMSF013M13+ GAGAATATTGGACCAGTAATCGGCCCATTTGGGATCGTTCTCGTAGTCGTACGCCGCCGC
                      ____________________________________________________________
consensus GAGAATATTGGACCAGTAATCGGCCCATTTGGGATCGTTCTCGTAGTCGTACGCCGCCGC
 
. : . : . : . : . : . :
JMSF004H19+ CGCTATCCTCTTCAGCTTCTGCGGATCCTCTCCTCCTCCTCCCATGTCCGCCGTTGACCT
JMSF013M13+ CGCTATCCTCTTCAGCTTCTGCGGATCCTCTCCTCCTCCTCCCATGTCCGCCGTTGACCT
                      ____________________________________________________________
consensus CGCTATCCTCTTCAGCTTCTGCGGATCCTCTCCTCCTCCTCCCATGTCCGCCGTTGACCT
 
. : . : . : . : . : . :
JMSF004H19+ TGAGTTCTGAGTCTTTTTACGGTCTACGATCGCTCGCTAGAGGGCGGAGATGTCCAGGAC
JMSF013M13+ TGAGTTCTGAGTCTTTTTACGGTCTACGATCGCTCGCTAGAGGGCGGAGATGTCCAGGAC
                      ____________________________________________________________
consensus TGAGTTCTGAGTCTTTTTACGGTCTACGATCGCTCGCTAGAGGGCGGAGATGTCCAGGAC
 
. : . : . : . : . : . :
JMSF004H19+ TCGAAGTAGTTTCTTCCAACCACAATTCTTTCTTCTTCTCGACTGCTATCAGTC
JMSF013M13+ TCGAAGTAGTTTCTTCCAACCACAATTCTTTCTTCTTCTCGACTGCTATCAGTCGCGCTC
                      ____________________________________________________________
consensus TCGAAGTAGTTTCTTCCAACCACAATTCTTTCTTCTTCTCGACTGCTATCAGTCGCGCTC