Previous Contig 005417:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS093G03Sequence316005417 (2)
JMSF013J13Sequence552005417 (2)gb:AY220479_15905132e-16Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 189 (ACRE189) mRNA, complet741022558gb:AY220479_15905133e-58Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 189 (ACRE189) mRNA, complet

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF013J13+ ACGAGGAGCCAC
                      ____________________________________________________________
consensus ACGAGGAGCCAC
 
. : . : . : . : . : . :
JMSF013J13+ TTCCGGCAGACGAGGGAGCAGCTTTTCCGGTCACCGGAGCTCAAGGATTGAAAAATCAGC
                      ____________________________________________________________
consensus TTCCGGCAGACGAGGGAGCAGCTTTTCCGGTCACCGGAGCTCAAGGATTGAAAAATCAGC
 
. : . : . : . : . : . :
JMFS093G03+ GCACCCTCCGAAACCGTCCTCCGAA
JMSF013J13+ GCTAAGCATTCGTCAGGAACCCCGTCGCTGTAATCGCACCCTCCGAAACCGTCCTCCGAA
                      ____________________________________________________________
consensus GCTAAGCATTCGTCAGGAACCCCGTCGCTGTAATCGCACCCTCCGAAACCGTCCTCCGAA
 
. : . : . : . : . : . :
JMFS093G03+ CTTGGCGCGGCGTCTTCATCCGACTGCACCATCGACAAAACATCCTGCTGTGAATGATCA
JMSF013J13+ CTTGGCGCGGCGTCTTCATCCGACTGCACCATCGACAAAACATCCTGCTGTGAATGATCA
                      ____________________________________________________________
consensus CTTGGCGCGGCGTCTTCATCCGACTGCACCATCGACAAAACATCCTGCTGTGAATGATCA
 
. : . : . : . : . : . :
JMFS093G03+ GACATTGATCGGCGATGTTTAGCAACAGGCTTCGGATAACAACTACGGGTACGGTGAGTA
JMSF013J13+ GACATTGATCGGCGATGTTTAGCAACAGGCTTCGGATAACAACTACGGTTACGGTGAGTA
                      ____________________________________________________________
consensus GACATTGATCGGCGATGTTTAGCAACAGGCTTCGGATAACAACTACGGTTACGGTGAGTA
 
. : . : . : . : . : . :
JMFS093G03+ GACCCACCAGGCCAGGATTGGTGGATCGACGGAGACTGGCCCATCCAGATTCGGCGATAT
JMSF013J13+ GACCCACCAGGCCAGGATTGGTGGATCGACGGAGACTGGCCCATCCAGATTCGGCGATAT
                      ____________________________________________________________
consensus GACCCACCAGGCCAGGATTGGTGGATCGACGGAGACTGGCCCATCCAGATTCGGCGATAT
 
. : . : . : . : . : . :
JMFS093G03+ AAGACACGAGGCCGATTCACGGCAAGCGCAATTCACGCGCCGCCCTAGATTCAACGCAGA
JMSF013J13+ AAGACACGAGGCCGATTCACGGCAAGCGCAATTCACGCGCCGCCCTAGATTCAACGCAGA
                      ____________________________________________________________
consensus AAGACACGAGGCCGATTCACGGCAAGCGCAATTCACGCGCCGCCCTAGATTCAACGCAGA
 
. : . : . : . : . : . :
JMFS093G03+ ATCGGGTGGTGTGCAGATTAGATTTGGGGATGAAAAAAAAACAAACAAACA
JMSF013J13+ ATCGGGTGGTGTACAGATTAGATTTGGGGATGAAAAAAAAACAAACAAACAAACGAGCGA
                      ____________________________________________________________
consensus ATCGGGTGGTGTGCAGATTAGATTTGGGGATGAAAAAAAAACAAACAAACAAACGAGCGA
 
. : . : . : . : . : . :
JMSF013J13+ TCGATGAATCTTTTGAGCAATTGGGGCAAATTGGCAAAGTTTTAATAGGAAGGAGGGTTT
                      ____________________________________________________________
consensus TCGATGAATCTTTTGAGCAATTGGGGCAAATTGGCAAAGTTTTAATAGGAAGGAGGGTTT
 
. : . : . : . : . : . :
JMSF013J13+ GACATTTGACCCGTCAAAACCAGATTGGACCGCCAAAGGGGCAACACCAATTTGTGCGCC
                      ____________________________________________________________
consensus GACATTTGACCCGTCAAAACCAGATTGGACCGCCAAAGGGGCAACACCAATTTGTGCGCC