Previous Contig 005415:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005F05Sequence148005415 (3)713005415 (3)gb:AB026650_15172542e-21Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MPF21.>gb:BT004765_1637
JMSF013J07Sequence254005415 (3)gb:AP005312_18503887e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P050688011747 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF005F05- AAATATTACAGCTAGATAGATTACAGAATATATATTGATGTGATGAATCTGATCTGCTGG
                      ____________________________________________________________
consensus AAATATTACAGCTAGATAGATTACAGAATATATATTGATGTGATGAATCTGATCTGCTGG
 
. : . : . : . : . : . :
rJMFF005F05- TACAAATTAAAATAAAGAAACTAAGTAAGTAACTGTAATTGAAATTGTATGTGGAAGTAA
                      ____________________________________________________________
consensus TACAAATTAAAATAAAGAAACTAAGTAAGTAACTGTAATTGAAATTGTATGTGGAAGTAA
 
. : . : . : . : . : . :
rJMFF005F05- TTAATGAGGTAGCTAGCTAGCTAACTCCGGCGGCGGCCTCGGAGATGCTCAGTAGTGAGG
                      ____________________________________________________________
consensus TTAATGAGGTAGCTAGCTAGCTAACTCCGGCGGCGGCCTCGGAGATGCTCAGTAGTGAGG
 
. : . : . : . : . : . :
rJMFF005F05- GTTGCCATGCGCCTTTGCATCTGCCTCCTCCTCCTCCTGCTCCTGCTGCAGAAGAAGAAG
                      ____________________________________________________________
consensus GTTGCCATGCGCCTTTGCATCTGCCTCCTCCTCCTCCTGCTCCTGCTGCAGAAGAAGAAG
 
. : . : . : . : . : . :
rJMFF005F05- ACCTATGCCTCCTTTCATGCTTTACATGCTGCTCAGATCTTCCAACGTAGTTAACTACTC
                      ____________________________________________________________
consensus ACCTATGCCTCCTTTCATGCTTTACATGCTGCTCAGATCTTCCAACGTAGTTAACTACTC
 
. : . : . : . : . : . :
rJMFF005F05- TTGTGTTTGATGAATCTGAATAAGTAGTTGATTTTTCATGCTTCTTAACCGGCCCTGACG
                      ____________________________________________________________
consensus TTGTGTTTGATGAATCTGAATAAGTAGTTGATTTTTCATGCTTCTTAACCGGCCCTGACG
 
. : . : . : . : . : . :
rJMFF005F05- ATGATGATGATGATAATTGCTGCTGCGAATGCCTCTTTGCCCATAACCCCTTCATTACTT
                      ____________________________________________________________
consensus ATGATGATGATGATAATTGCTGCTGCGAATGCCTCTTTGCCCATAACCCCTTCATTACTT
 
. : . : . : . : . : . :
rJMFF005F05- CTTGAGCGGTTACTAGTCTATAAACATGTCCAAGAACAAGAGTGTCTGTTGGCTTGAGGA
                      ____________________________________________________________
consensus CTTGAGCGGTTACTAGTCTATAAACATGTCCAAGAACAAGAGTGTCTGTTGGCTTGAGGA
 
. : . : . : . : . : . :
rJMFF005F05- GCTTAATACGTGTAATCCTCCGAAGTGGCGGGATATTATTTTTGGTATTGTTGGTGGCGG
                      ____________________________________________________________
consensus GCTTAATACGTGTAATCCTCCGAAGTGGCGGGATATTATTTTTGGTATTGTTGGTGGCGG
 
. : . : . : . : . : . :
rJMFF005F05- TGGTGGTAGTAGTAAGGAGAAGAGCGACATAGTGGCCGGGATTGGTGTTCATGATTTGGG
JMSF013J07+ GTTCATGATTTGGG
                      ____________________________________________________________
consensus TGGTGGTAGTAGTAAGGAGAAGAGCGACATAGTGGCCGGGATTGGTGTTCATGATTTGGG
 
. : . : . : . : . : . :
rJMFF005F05- TGGCGGAGAGAGGCCAATAGTGCTTCTCTACTCTCCCGCCAGGGTGTTGTATTACCAGAC
JMSF013J07+ TGGCGGAGAGAGGCCAATAGTGCTTCTCTACTCTCCCGCCAGGGTGTTGTATTACCAGAC
                      ____________________________________________________________
consensus TGGCGGAGAGAGGCCAATAGTGCTTCTCTACTCTCCCGCCAGGGTGTTGTATTACCAGAC
 
. : . : . : . : . : . :
rJMFF005F05- TTGAGTTGTCGTCTATGGCTTGGCAGTTCCCCATTGATTTTATTTCCTCCGAT
JMFF005F05+ GAGTTGTCGTNTATGGCTNGGCAGTTCCCCATTGATNTTATTTCCTCCGATCCGCTAG
JMSF013J07+ TTGAGTTGTCGTCTATGGCTTGGCAGTTCCCCATTGATTTTATTTCCTCCGATCCGCTAG
                      ____________________________________________________________
consensus TTGAGTTGTCGTCTATGGCTTGGCAGTTCCCCATTGATTTTATTTCCTCCGATCCGCTAG
 
. : . : . : . : . : . :
JMFF005F05+ GATACCTCGCTTCTTTCTTCTATATATATTTGTTTTTCTTCCGATCCGATCCTCTCTGCA
JMSF013J07+ GATACCTCGCTTCTTTCTTCTATATATATTTGTTTTTCTTCCGATCCGATCCTCTCTGCA
                      ____________________________________________________________
consensus GATACCTCGCTTCTTTCTTCTATATATATTTGTTTTTCTTCCGATCCGATCCTCTCTGCA
 
. : . : . : . : . : . :
JMFF005F05+ ATTCAAGCAAGTCTACCACAAAATTATAAT
JMSF013J07+ ATTCAAGCAAGTCTACCACAAAATTATAATAAGTATTCAACTCATCTCTCTCTATATATC
                      ____________________________________________________________
consensus ATTCAAGCAAGTCTACCACAAAATTATAATAAGTATTCAACTCATCTCTCTCTATATATC