Previous Contig 005412:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF013I18Sequence511005412 (2)gb:BT020264_16426591e-24Arabidopsis thaliana At5g19500 gene, complete cds.>gb:BT020459_1642853 Arabidops735012516 (2)gb:AC136471_17431882e-53Solanum demissum chromosome 11 BAC PGEC561 genomic sequence, complete sequence.
JMSF027A20Sequence668005412 (2)gb:BT020264_16426591e-59Arabidopsis thaliana At5g19500 gene, complete cds.>gb:BT020459_1642853 Arabidops685012516 (2)gb:AC136471_17431883e-37Solanum demissum chromosome 11 BAC PGEC561 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027A20+ AATG
                      ____________________________________________________________
consensus AATG
 
. : . : . : . : . : . :
JMSF027A20+ GAATGCCAAGGAAGCTTGTTAATATATCTGAAGATCGAGCCACGTAAGCAACAAGAAGAG
                      ____________________________________________________________
consensus GAATGCCAAGGAAGCTTGTTAATATATCTGAAGATCGAGCCACGTAAGCAACAAGAAGAG
 
. : . : . : . : . : . :
JMSF027A20+ CATAATGAATGAAAATGTATGACCAGCAAGCAATTTGAACTCCTGTATTACCAAGGGTTC
                      ____________________________________________________________
consensus CATAATGAATGAAAATGTATGACCAGCAAGCAATTTGAACTCCTGTATTACCAAGGGTTC
 
. : . : . : . : . : . :
JMSF027A20+ TCCTGGCCATTGACACCAAGGACACACCACCAGAACCCAGCTCACACATAGTGTTCACAT
                      ____________________________________________________________
consensus TCCTGGCCATTGACACCAAGGACACACCACCAGAACCCAGCTCACACATAGTGTTCACAT
 
. : . : . : . : . : . :
JMSF027A20+ TCACTTCAGCAATTAGTAGCCCAGTTATGACCATAAAAATCCAACAGCCAATGCAGGTCA
JMSF013I18+ ACCATAAAANTCCANCAGCCAATGCAGGTCA
                      ____________________________________________________________
consensus TCACTTCAGCAATTAGTAGCCCAGTTATGACCATAAAAATCCAACAGCCAATGCAGGTCA
 
. : . : . : . : . : . :
JMSF027A20+ CTGCAGAGGCAAGAAACCCAGATTCTTGTGTCACTGCAGGAATTGCAAGTATCCCTGCAC
JMSF013I18+ CTGCAGAGGCAAGAAACCCAGATTCTTGTGTCACTGCAGGAATTGCAAGTATCCCTGCAC
                      ____________________________________________________________
consensus CTGCAGAGGCAAGAAACCCAGATTCTTGTGTCACTGCAGGAATTGCAAGTATCCCTGCAC
 
. : . : . : . : . : . :
JMSF027A20+ CTATTGTGGTGCCAGCAACAAGAAAAATGGCACTGCTAAGGCTTCCTGGTTCTCTCTTCA
JMSF013I18+ CTATTGTGGTGCCAGCAACAAGAAAAATGGCACTGCTAAGGCTTCCTGGTTCTCTCTTCA
                      ____________________________________________________________
consensus CTATTGTGGTGCCAGCAACAAGAAAAATGGCACTGCTAAGGCTTCCTGGTTCTCTCTTCA
 
. : . : . : . : . : . :
JMSF027A20+ AAGTAGCTTGATTGAGGTTAGAAAACAACCTCTCAAATTCATACACTTGTTCATCTTCCT
JMSF013I18+ AAGTAGCTTGATTGAGGTTAGAAAACAACCTCTCAAATTCATACACTTGTTCATCTTCCT
                      ____________________________________________________________
consensus AAGTAGCTTGATTGAGGTTAGAAAACAACCTCTCAAATTCATACACTTGTTCATCTTCCT
 
. : . : . : . : . : . :
JMSF027A20+ GTTGTCCAGAGGATGCTGACGACGGTTTTCCAGATAATGACTTGAAAGCATCAAGACGGC
JMSF013I18+ GTTGTCCAGAGGATGCTGACGACGGTTTTCCAGATAATGACTTGAAAGCATCAAGACGGC
                      ____________________________________________________________
consensus GTTGTCCAGAGGATGCTGACGACGGTTTTCCAGATAATGACTTGAAAGCATCAAGACGGC
 
. : . : . : . : . : . :
JMSF027A20+ GTCGTCCATCAGATGAAATCCAAGTTGGCAGCATTAAAGAATGGTTCTTGGAATTCCAAT
JMSF013I18+ GTCGTCCATCAGATGAAATCCAAGTTGGCAGCATTAAAGAATGGTTCTTGGAATTCCAAT
                      ____________________________________________________________
consensus GTCGTCCATCAGATGAAATCCAAGTTGGCAGCATTAAAGAATGGTTCTTGGAATTCCAAT
 
. : . : . : . : . : . :
JMSF027A20+ TGGAAGTAAATTTATGAAATGGGTTTGCTGCATTGCTTCTGTGATTGTGAAGTGCAGCCT
JMSF013I18+ TGGAAGTAAATTTATGAAATGGGTTTGCTGCATTGCTTCTGTGATTGTGAAGTGCAGCCT
                      ____________________________________________________________
consensus TGGAAGTAAATTTATGAAATGGGTTTGCTGCATTGCTTCTGTGATTGTGAAGTGCAGCCT
 
. : . : . : . : . : . :
JMSF027A20+ TGGGACGACAAAGGAATTTTGCAGAAGAGGATAAAGATGAGGCTGCCATTATCATACTGC
JMSF013I18+ TGGGACGACAAAGGAATTTTGCAGAAGAGGATAAAGATGAGGCTGCCATTATCATACTGC
                      ____________________________________________________________
consensus TGGGACGACAAAGGAATTTTGCAGAAGAGGATAAAGATGAGGCTGCCATTATCATACTGC
 
. : . : . : . : . : . :
JMSF027A20+ TCT
JMSF013I18+ TCTGCTATGTTTCTTGCGTGTATTGGGTCTTCAATTCTTCTGGGTTGCGATGTCTGCTCC
                      ____________________________________________________________
consensus TCTGCTATGTTTCTTGCGTGTATTGGGTCTTCAATTCTTCTGGGTTGCGATGTCTGCTCC