Previous Contig 005411:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022G15Sequence444005411 (2)pir|T47582|T475820.048hypothetical protein F24B22.190 - Arabidopsis thaliana>gb:ATF24B22_1549832 Arabi668021164gb:AY070066_15667081e-17Arabidopsis thaliana unknown protein (At3g54230) mRNA, complete cds.>gb:AY096433
JMSF013I02Sequence490005411 (2)gb:AY070066_15667085e-05Arabidopsis thaliana unknown protein (At3g54230) mRNA, complete cds.>gb:AY096433

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF022G15+ CTTTTA
                      ____________________________________________________________
consensus CTTTTA
 
. : . : . : . : . : . :
JMFF022G15+ AACATCTGTTCACTCACCGGAAGTCATGCTCATGGACTCCACCATAACCCTCCAAAGCCT
                      ____________________________________________________________
consensus AACATCTGTTCACTCACCGGAAGTCATGCTCATGGACTCCACCATAACCCTCCAAAGCCT
 
. : . : . : . : . : . :
JMFF022G15+ GTGGATTCAAGACAATAAGCTATGTCAGCAATTAATTATCATGGTACAAGGTAGGGAAAT
                      ____________________________________________________________
consensus GTGGATTCAAGACAATAAGCTATGTCAGCAATTAATTATCATGGTACAAGGTAGGGAAAT
 
. : . : . : . : . : . :
JMFF022G15+ CCATTCCACATCCTCACTGTCCCAAGGCTTTCTTTCAATGTTCTTTAAGGAAGAGATGTC
                      ____________________________________________________________
consensus CCATTCCACATCCTCACTGTCCCAAGGCTTTCTTTCAATGTTCTTTAAGGAAGAGATGTC
 
. : . : . : . : . : . :
JMFF022G15+ TGAAAATGGGACAGTCTCATGAGCCTAGTTTCTTGTTTATCATCCCATATATGTGATTAA
                      ____________________________________________________________
consensus TGAAAATGGGACAGTCTCATGAGCCTAGTTTCTTGTTTATCATCCCATATATGTGATTAA
 
. : . : . : . : . : . :
JMFF022G15+ GAAGGAAACCACAATTACGCTGTTATTTTCCCATCCTTGCTGAGGGCAATATCGACCAGG
JMSF013I02+ CGCTGTTATTTTCCCATCCTTGCTGAGGGCAATATCGACCAGG
                      ____________________________________________________________
consensus GAAGGAAACCACAATTACGCTGTTATTTTCCCATCCTTGCTGAGGGCAATATCGACCAGG
 
. : . : . : . : . : . :
JMFF022G15+ ATCCATTTCTTGCAAGAAGACTGGTGCTACCCCTACAAAGTTGTGCACGATCTTTCAGAA
JMSF013I02+ ATCCATTTCTTGCAAGAAGACTGGTGCTACCCCTACAAAGTTGTGCACGATCTTTCAGAA
                      ____________________________________________________________
consensus ATCCATTTCTTGCAAGAAGACTGGTGCTACCCCTACAAAGTTGTGCACGATCTTTCAGAA
 
. : . : . : . : . : . :
JMFF022G15+ GATTCAGGAGCAAGATGACTGAAAACCTTTCAATTAAACCGCTGCAGAATCGAGGAAACA
JMSF013I02+ GATTCAGGAGCAAGATGACTGAAAACCTTTCAATTAAACCGCTGCAGAATCGAGGAAACA
                      ____________________________________________________________
consensus GATTCAGGAGCAAGATGACTGAAAACCTTTCAATTAAACCGCTGCAGAATCGAGGAAACA
 
. : . : . : . : . : . :
JMFF022G15+ GCTCCGATTGTGATTCCC
JMSF013I02+ GCTCCGATTGTGATTCCCGGAGCTCCACCCGGATCGATTCTACAAATCAAATCAAATCCA
                      ____________________________________________________________
consensus GCTCCGATTGTGATTCCCGGAGCTCCACCCGGATCGATTCTACAAATCAAATCAAATCCA
 
. : . : . : . : . : . :
JMSF013I02+ AATACGACGAATAGCTTGACCGATTACAGGCTGAAGGTCTTCTACGAAGCATAAATTGAA
                      ____________________________________________________________
consensus AATACGACGAATAGCTTGACCGATTACAGGCTGAAGGTCTTCTACGAAGCATAAATTGAA
 
. : . : . : . : . : . :
JMSF013I02+ GGCAGAGAGGTGGGGGTGGGAAATCTGAATAAACAAACCCTAAGACACTGTTATTTGTCC
                      ____________________________________________________________
consensus GGCAGAGAGGTGGGGGTGGGAAATCTGAATAAACAAACCCTAAGACACTGTTATTTGTCC