Previous Contig 005410:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS023D05Sequence529005410 (9)pir|T50670|T506707e-35actin bundling protein ABP135 [imported] - trumpet lily>gb:AF088901_1767272 Lili
JMFS035E05Sequence626005410 (9)pir|T50670|T506705e-50actin bundling protein ABP135 [imported] - trumpet lily>gb:AF088901_1767272 Lili
JMFS092F06Sequence618005410 (9)pir|T50670|T506704e-73actin bundling protein ABP135 [imported] - trumpet lily>gb:AF088901_1767272 Lili
JMFS095D06Sequence626005410 (9)pir|T50670|T506703e-81actin bundling protein ABP135 [imported] - trumpet lily>gb:AF088901_1767272 Lili
JMFS099H02Sequence606005410 (9)pir|T50670|T506702e-64actin bundling protein ABP135 [imported] - trumpet lily>gb:AF088901_1767272 Lili
JMFS128D07Sequence621005410 (9)pir|T50670|T506704e-73actin bundling protein ABP135 [imported] - trumpet lily>gb:AF088901_1767272 Lili
JMFS129G02Sequence627005410 (9)pir|T50670|T506702e-78actin bundling protein ABP135 [imported] - trumpet lily>gb:AF088901_1767272 Lili
JMSF013H15Sequence520005410 (9)759009562 (3)gb:NTA577853_16914322e-29Nicotiana tabacum partial mRNA for villin 2 (vln2 gene).
JMSF028I10Sequence625005410 (9)pir|T50670|T506701e-63actin bundling protein ABP135 [imported] - trumpet lily>gb:AF088901_1767272 Lili684009562 (3)gb:NTA577853_16914326e-30Nicotiana tabacum partial mRNA for villin 2 (vln2 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS095D06+ TCTTTAGTATCCAGAATAAACACATCGTCATGGTTTAGCGATG
JMFS129G02+ ATAAACACATCGTCATGGTTTAGCGATG
                      ____________________________________________________________
consensus TCTTTAGTATCCAGAATAAACACATCGTCATGGTTTAGCGATG
 
. : . : . : . : . : . :
JMFS095D06+ ATCGAGAAAATGGGACCTGCTTCAACCTGACAACCCTTTTTCCTTTACAAACATACAACC
JMFS129G02+ ATCGAGAAAATGGGACCTGCTTCAACCTGACAACCCTTTTTCCTTTACAAACATACAACC
JMFS092F06+ AAATGGGACCTGCTTCAACCTGACAACCCTTTTTCCTTTACAAACATACAACC
JMFS128D07+ AAATGGGACCTGCTTCAACCTGACAACCCTTTTTCCTTTACAAACATACAACC
JMFS099H02+ CATACAACC
                      ____________________________________________________________
consensus ATCGAGAAAATGGGACCTGCTTCAACCTGACAACCCTTTTTCCTTTACAAACATACAACC
 
. : . : . : . : . : . :
JMFS095D06+ GTGTTTCAAACTCTTCTTCCTCCACCTCCTTAAATCCAGATGCAACACCGCCTTCCAATG
JMFS129G02+ GTGTTTCAAACTCTTCTTCCTCCACCTCCTTAAATCCAGATGCAAAACCGCCTTCCAATG
JMFS092F06+ GTGTTTCAAACTCTTCTTCCTCCACCTCCTTAAATCCAGATGCAACACCGCCTTCCAATG
JMFS128D07+ GTGTTTCAAACTCTTCTTCCTCCACCTCCTTAAATCCAGATGCAACACCGCCTTCCAATG
JMFS099H02+ GTGTTTCAAACTCTTCTTCCTCCACCTCCTTAAATCCAGATGCAACACCGCCTTCCAATG
JMSF028I10+ TCTTCCTCCACCTCCTTAAATCCAGATGCAACACCGCCTTCCAATG
                      ____________________________________________________________
consensus GTGTTTCAAACTCTTCTTCCTCCACCTCCTTAAATCCAGATGCAACACCGCCTTCCAATG
 
. : . : . : . : . : . :
JMFS095D06+ GTATAATGCAGGGCTTGAAGTAGGATAAGAATTTATCAGTTTCATGA-CCTTGGACTTCT
JMFS129G02+ GTATAATGCAGGGCTTGAAGTAGGATAAGAATTTATCAGTTTCATGA-CCTTGGACTTCT
JMFS092F06+ GTATAATACAGGGCTTGAAGTAGGATAAGAATTTATCAGTTTCATGA-CCTTGGACTTCT
JMFS128D07+ GTATAATGCAGGGCTTGAAGTAGGATAAGAATTTATCAGTTTCATGA-CCTTGGACTTCT
JMFS099H02+ GTATAATGCAGGGCTTGAAGTAGGATAAGAATTTATCAGTTTCATGA-CCTTGGACTTCT
JMSF028I10+ GTATAATGCAGGGCTTGAAGTAGGATAAGAATTTATCAGTTTCATGA-CCTTGGACTTCT
JMFS035E05+ TAGGATAAGAATTTATCAG-TTCATGACCCTTGGACTTCT
                      ____________________________________________________________
consensus GTATAATGCAGGGCTTGAAGTAGGATAAGAATTTATCAGTTTCATGA-CCTTGGACTTCT
 
. : . : . : . : . : . :
JMFS095D06+ CTATACTGTACCGCTCGCCCTCCAAGAATCGCATCGAGTTCTACAGTTTTAATTGCAGCT
JMFS129G02+ CTATACTGTACCGCTCGCCCTCCAAGAATCGCATCGAGTTCTACAGTTTTAATTGCAGCT
JMFS092F06+ CTATACTGTACCGCTCGCCCTCCAAGAATCGCATCGAGTTCTACAGTTTTAATTGCAGCT
JMFS128D07+ CTATACTGTACCGCTCGCCCTCCAAGAATCGCATCGAGTTCTACAGTTTTAATTGCAGCT
JMFS099H02+ CTATACTGTACCGCTCGCCCTCCAAGAATCGCATCGAGTTCTACAGTTTTAATTGCAGCT
JMSF028I10+ CTATACTGTACCGCTCGCCCTCCAAGAATCGCATCGAGTTCTACAGTTTTAATTGCAGCT
JMFS035E05+ CTATACTGTACCGCTCGCCCTCCAAGAATCGCATCGAGTTCTACAGTTTTAATTGCAGCT
                      ____________________________________________________________
consensus CTATACTGTACCGCTCGCCCTCCAAGAATCGCATCGAGTTCTACAGTTTTAATTGCAGCT
 
. : . : . : . : . : . :
JMFS095D06+ GTTCCAGCTTCATCCTGACTAGTATCCTTCCCAAGCCAGAAATGTATATCATACAAATAA
JMFS129G02+ GTTCCAGCTTCATCCTGACTAGTATCCTTCCCAAGCCAGAAATGTATATCATACAAATAA
JMFS092F06+ GTTCCAGCTTCATCCTGACTAGTATCCTTCCCAAGCCAGAAATGTATATCATACAAATAA
JMFS128D07+ GTTCCAGCTTCATCCTGACTAGTATCCTTCCCAAGCCAGAAATGTATATCATACAAATAA
JMFS099H02+ GTTCCAGCTTCATCCTGACTAGTATCCTTCCCAAGCCAGAAATGTATATCATACAAATAA
JMSF028I10+ GTTCCAGCTTCATCCTGACTAGTATCCTTCCCAAGCCAGAAATGTATATCATACAAATAA
JMFS035E05+ GTTCCAGCTTCATCCTGACTAGTATCCTTCCCAAGCCAGAAATGTATATCATACAAATAA
JMFS023D05+ TCCAGCTTCATCCTGACTAGTATCCTTCCCAAGCCAGAAATGTATATCATACAAATAA
                      ____________________________________________________________
consensus GTTCCAGCTTCATCCTGACTAGTATCCTTCCCAAGCCAGAAATGTATATCATACAAATAA
 
. : . : . : . : . : . :
JMFS095D06+ GCACCACCCTTACCAGAAGTTGTCTGCAAGATGATGTAAGAGTCCCCCGAGTAGAATTTA
JMFS129G02+ GCACCACCCTTACCAGAAGTTGTCTGCAAGATGATGTAAGAGTCCCCCGAGTAGAATTTA
JMFS092F06+ GCACCACCCTTACCAGAAGTTGTCTGCAAGATGATGTAAGAGTCCCCCGAGTAGAATTTA
JMFS128D07+ GCACCACCCTTACCAGAAGTTGTCTGCAAGATGATGTAAGAGTCCCCCGAGTAGAATTTA
JMFS099H02+ GCACCACCCTTACCAGAAGTTGTCTGCAAGATGATGTAAGAGTCCCCCGAGTAGAATTTA
JMSF028I10+ GCACCACCCTTACCAGAAGTTGTCTGCAAGATGATGTAAGAGTCCCCCGAGTAGAATTTA
JMFS035E05+ GCACCACCCTTACCAGAAGTTGTCTGCAAGATGATGTAAGAGTCCCCCGAGTAGAATTTA
JMFS023D05+ GCACCACCCTTACCAGAAGTTGTCTGCAAGATGATGTAAGAGTCCCCCGAGTAGAATTTA
                      ____________________________________________________________
consensus GCACCACCCTTACCAGAAGTTGTCTGCAAGATGATGTAAGAGTCCCCCGAGTAGAATTTA
 
. : . : . : . : . : . :
JMFS095D06+ CCATAATCAGATTTGGGTAATGGAACTGGTTGGAAATTTTCAATTCTCCAAATCTCAGTC
JMFS129G02+ CCATAATCAGATTTGGGTAATGGAACTGGTTGGAAATTTTCAATTCTCCAAATCTCAGTC
JMFS092F06+ CCATAATCAGATTTGGGTAATGGAACTGGTTGGAAATTTTCAATTCTCCAAATCTCAGTC
JMFS128D07+ CCATAATCAGATTTGGGTAATGGAACTGGTTGGAAATTTTCAATTCTCCAAATCTCAGTC
JMFS099H02+ CCATAATCAGATTTGGGTAATGGAACTGGTTGGAAATTTTCAATTCTCCAAATCTCAGTC
JMSF028I10+ CCATAATCAGATTTGGGTAATGGAACTGGTTGGAAATTTTCAATTCTCCAAATCTCAGTC
JMFS035E05+ CCATAATCAGATTTGGGTAATGGAACTGGTTGGAAATTTTCAATTCTCCAAATCTCAGTC
JMFS023D05+ CCATAATCAGATTTGGGTAATGGAACTGGTTGGAAATTTTCAATTCTCCAAATCTCAGTC
                      ____________________________________________________________
consensus CCATAATCAGATTTGGGTAATGGAACTGGTTGGAAATTTTCAATTCTCCAAATCTCAGTC
 
. : . : . : . : . : . :
JMFS095D06+ CCAACTCTTTGCCCTGCTCCCTGAAATGCAGGTTCCAACTCTTTCACAGAGCTAGACATT
JMFS129G02+ CCAACTCTTTGCCCTGCTCCCTGAAATGCAGGTTCCAACTCTTTCACAGAGCTAGACATT
JMFS092F06+ CCAACTCTTTGCCCTGCTCCCTGAAATGCAGGTTCCAACTCTTTCACAGAGCTAGACATT
JMFS128D07+ CCAACTCTTTGCCCTGCTCCCTGAAATGCAGGTTCCAACTCTTTCACAGAGCTAGACATT
JMFS099H02+ CCAACTCTTTGCCCTGCTCCCTGAAATGCAGGTTCCAACTCTTTCACAGAGCTAGACATT
JMSF028I10+ CCAACTCTTTGCCCTGCTCCCTGAAATGCAGGTTCCAACTCTTTCACAGAGCTAGACATT
JMFS035E05+ CCAACTCTTTGCCCTGCTCCCTGAAATGCAGGTTCCAACTCTTTCACAGAGCTAGACATT
JMFS023D05+ CCAACTCTTTGCCCTGCTCCCTGAAATGCAGGTTCCAACTCTTTCACAGAGCTAGACATT
JMSF013H15+ CCTGAAATGCAGGTTCCAACTCTTTCACAGAGCTAGACATT
                      ____________________________________________________________
consensus CCAACTCTTTGCCCTGCTCCCTGAAATGCAGGTTCCAACTCTTTCACAGAGCTAGACATT
 
. : . : . : . : . : . :
JMFS095D06+ GTATAAACTCCTTGAATTCCTCGTACACTTCAAAAGAGAAAGAACACTATACCTTGTG-A
JMFS129G02+ GTATAAACTCCTTGAATTCCTCGTACACTTCAAAAGAGAAAGAACACTATACCTTGTG-A
JMFS092F06+ GTATAAACTCCTTGAATTCCTCGTACACTTCAAAAGAGAAAGAACACTATACCTTGTG-A
JMFS128D07+ GTATAAACTCCTTGAATTCCTCGTACACTTCAAAAGAGAAAGAACACTATACCTTGTG-A
JMFS099H02+ GTATAAACTCCTTGAATTCCTCGTACACTTCAAAAGAGAAAGAACACTATACCTTGTG-A
JMSF028I10+ GTATAAACTCCTTGAATTCCTCGTACACTTCAAAAGAGAAAGAACACTATACCTTGTGAA
JMFS035E05+ GTATAAACTCCTTGAATTCCTCGTACACTTCAAAAGAGAAAGAACACTATACCTTGTG-A
JMFS023D05+ GTATAAACTCCTTGAATTCCTCGTACACTTCAAAAGAGAAAGAACACTATACCTTGTG-A
JMSF013H15+ GTATAAACTCCTTGAATTCCTCGTACACTTCAAAAGAGAAAGAACACTATACCTTGTG-A
                      ____________________________________________________________
consensus GTATAAACTCCTTGAATTCCTCGTACACTTCAAAAGAGAAAGAACACTATACCTTGTG-A
 
. : . : . : . : . : . :
JMFS095D06+ ACTATTCCACAAAAACTAACTCAAAAGATCTCCCTTTCTCTCTCA
JMFS129G02+ ACTATTCCACAAAAACTAACTCAAAAGATCTCCCTTTCTCTCTCACTCTCTCTGCACCTG
JMFS092F06+ ACTATTCCACAAAAACTAACTCAAAAGATCTCCCTTTCTCTCTCACTCTCTCTGCACCTG
JMFS128D07+ ACTATTCCACAAAAACTAACTCAAAAGATCTCCCTTTCTCTCTCACTCTCTCTGCACCTG
JMFS099H02+ ACTATTCCACAAAAACTAACTCAAAAGATCTCCCTTTCTCTCTCACTCTCTCTGCACCTG
JMSF028I10+ ACTATTCCACAAAAACTAACTCAAAAGATCTCCCTTTCTCTCTCACTCTCTCTGCACCTG
JMFS035E05+ ACTATTCCACAAAAACTAACTCAAAAGATCTCCCTTTCTCTCTCACTCTCTCTGCACCTG
JMFS023D05+ ACTATTCCACAAAAACTAACTCAAAAGATCTCCCTTTCTCTCTCACTCTCTCTGCACCTG
JMSF013H15+ ACTATTCCACAAAAACTAACTCAAAAGATCTCCCTTTCTCTCTCACTCTCTCTGCACCTG
                      ____________________________________________________________
consensus ACTATTCCACAAAAACTAACTCAAAAGATCTCCCTTTCTCTCTCACTCTCTCTGCACCTG
 
. : . : . : . : . : . :
JMFS129G02+ T
JMFS092F06+ TGGAAGATAAACTGGCGATGGTGATCA
JMFS128D07+ TGGAAGATAAACTGGCGATGGTGATCAGAA
JMFS099H02+ TGGAAGATAAACTGGCGATGGTGATCAGAATTATGGGTGTAGAGAGAGAGAAGAAAAGA
JMSF028I10+ TGGAAGATAAACTGGCGATGGTGATCAGAATTATGGGTGTAGAGAGAGAGAAGAAAAGAG
JMFS035E05+ TGGAAGATAAACTGGCGATGGTGATCAGAATTATGGGTGTAGAGAGAGAGAAGAAAAGAG
JMFS023D05+ TGGAAGATAAACTGGCGATGGTGATCAGAATTATGGGTGTAGAGAGAGAGAAGAAAAGAG
JMSF013H15+ TGGAAGATAAACTGGCGATGGTGATCAGAATTATGGGTGTAGAGAGAGAGAAGAAAAGAG
                      ____________________________________________________________
consensus TGGAAGATAAACTGGCGATGGTGATCAGAATTATGGGTGTAGAGAGAGAGAAGAAAAGAG
 
. : . : . : . : . : . :
JMSF028I10+ TATAGAGAAAGAGAGAGGGAAGGGTATAGCAGAGCTGGC
JMFS035E05+ TATAGAGAAAGAGAGAGGGAAGGGTATAGCAGAGCTGGCAAATAAAAGAGAGAGAGAGTG
JMFS023D05+ TATAGAGAAAGAGAGAGGGAAGGGTATAGCAGAGCTGGCAAATAAAAGAGAGAGAGAGTG
JMSF013H15+ TATAGAGAAAGAGAGAGGGAAGGGTATAGCAGAGCTGGCAAATAAAAGAGAGAGAGAGTG
                      ____________________________________________________________
consensus TATAGAGAAAGAGAGAGGGAAGGGTATAGCAGAGCTGGCAAATAAAAGAGAGAGAGAGTG
 
. : . : . : . : . : . :
JMFS035E05+ TATGTGGGGAAAAGGAGTGAATAATTGAAAAACTTCTGCCTCTTTCTC
JMFS023D05+ TATGTGGGGAAAAGGAGTGAATAATTGAAAAACTTCTGCCTCTTTCTC
JMSF013H15+ TATGTGGGGAAAAGGAGTGAATAATTGAAAAACTTCTGCCTCTTTCTCTCTCTCTCTCTC
                      ____________________________________________________________
consensus TATGTGGGGAAAAGGAGTGAATAATTGAAAAACTTCTGCCTCTTTCTCTCTCTCTCTCTC
 
. : . : . : . : . : . :
JMSF013H15+ TCTCCTCCTAGCTTTTTGAGACTTTTGAGATTTGAGTGCAGAAATTTTGGTATTTCTTTT
                      ____________________________________________________________
consensus TCTCCTCCTAGCTTTTTGAGACTTTTGAGATTTGAGTGCAGAAATTTTGGTATTTCTTTT
 
. : . : . : . : . : . :
JMSF013H15+ GCAGACAGACAGTATGTGCGAATTTTAGAGAGATAATGGATAGCATACACTGGTAAGTAT
                      ____________________________________________________________
consensus GCAGACAGACAGTATGTGCGAATTTTAGAGAGATAATGGATAGCATACACTGGTAAGTAT
 
. : . : . : . : . : . :
JMSF013H15+ ATACTTGTAGAGTTGTAGAGAGAGAAACAGCACAAACAGTGACGAATGATGATGAAGACC
                      ____________________________________________________________
consensus ATACTTGTAGAGTTGTAGAGAGAGAAACAGCACAAACAGTGACGAATGATGATGAAGACC