Previous Contig 005405:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF049J23Sequence600005405 (3)pir|T09935|T099352e-43hypothetical protein T16L4.230 - Arabidopsis thaliana>gb:ATCHRIV71_1546893 Arabi227021867
JMSF011H07Sequence373005405 (3)pir|T09935|T099352e-24hypothetical protein T16L4.230 - Arabidopsis thaliana>gb:ATCHRIV71_1546893 Arabi761011631 (2)gb:AY188087_15881761e-70Brassica juncea putative polyamine oxidase (PAO) mRNA, complete cds.
JMSF013G18Sequence491005405 (3)pir|T09935|T099352e-24hypothetical protein T16L4.230 - Arabidopsis thaliana>gb:ATCHRIV71_1546893 Arabi633011631 (2)gb:AY188087_15881762e-52Brassica juncea putative polyamine oxidase (PAO) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF049J23+ TCACCATATCTTCCTCTTTCCTGATTTCNCAATATGCAGCAAGCCCTTTTCTA
                      ____________________________________________________________
consensus TCACCATATCTTCCTCTTTCCTGATTTCNCAATATGCAGCAAGCCCTTTTCTA
 
. : . : . : . : . : . :
JMFF049J23+ AGAAAAGAACCAACACTCACACTTTCATGGCAGCCACCATTCTTTATACACCACCCATTT
                      ____________________________________________________________
consensus AGAAAAGAACCAACACTCACACTTTCATGGCAGCCACCATTCTTTATACACCACCCATTT
 
. : . : . : . : . : . :
JMFF049J23+ GAAGACTTTTCAGCTTCCATGGCTTTACCCTGAGCAAAATTCATGAGCTTTGTGAAAAGG
                      ____________________________________________________________
consensus GAAGACTTTTCAGCTTCCATGGCTTTACCCTGAGCAAAATTCATGAGCTTTGTGAAAAGG
 
. : . : . : . : . : . :
JMFF049J23+ GTGTATATGGGCTCAACCATAGATGAGCTAAACTCATATCCACCTTCTGCAATGGTCACT
                      ____________________________________________________________
consensus GTGTATATGGGCTCAACCATAGATGAGCTAAACTCATATCCACCTTCTGCAATGGTCACT
 
. : . : . : . : . : . :
JMFF049J23+ GCCTCCTCTGAAGACCCATCCATACACTCCCATGGCTGTTCAGACTTGAGAGAATTGATT
JMSF011H07+ GAGAATTGATT
JMSF013G18+ GAGAATTGATT
                      ____________________________________________________________
consensus GCCTCCTCTGAAGACCCATCCATACACTCCCATGGCTGTTCAGACTTGAGAGAATTGATT
 
. : . : . : . : . : . :
JMFF049J23+ TCTTGAGCAATCCTGTAAACTGGGCTGCCCCCAATTCCATGGATCCAAGTAGCACCCATC
JMSF011H07+ TCTTGAGCAATCCTGTAAACTGGGCTGCCCCCAATTCCATGGATCCAAGTAGCACCCATC
JMSF013G18+ TCTTGAGCAATCCTGTAAACTGGGCTGCCCCCAATTCCATGGATCCAAGTAGCACCCATC
                      ____________________________________________________________
consensus TCTTGAGCAATCCTGTAAACTGGGCTGCCCCCAATTCCATGGATCCAAGTAGCACCCATC
 
. : . : . : . : . : . :
JMFF049J23+ TCAATCCTATCACCACCAAACTCTGAGGTGTTAATCCTCCCACCAATCCTGTTCCCTGCC
JMSF011H07+ TCAATCCTATCACCACCAAACTCTGAGGTGTTAATCCTCCCACCAATCCTGTTCCCTGCC
JMSF013G18+ TCAATCCTATCACCACCAAACTCTGAGGTGTTAATCCTCCCACCAATCCTGTTCCCTGCC
                      ____________________________________________________________
consensus TCAATCCTATCACCACCAAACTCTGAGGTGTTAATCCTCCCACCAATCCTGTTCCCTGCC
 
. : . : . : . : . : . :
JMFF049J23+ TCCAACACACACACCTCAAACACCTCTTTTGAGCCTGCAGCTGTGTAGAGCTTGTTTGCT
JMSF011H07+ TCCAACACACACACCTCAAACACCTCTTTTGAGCCTGCAGCTGTGTAGAGCTTGTTTGCT
JMSF013G18+ TCCAACACACACACCTCAAACACCTCTTTTGAGCCTGCAGCTGTGTAGAGCTTGTTTGCT
                      ____________________________________________________________
consensus TCCAACACACACACCTCAAACACCTCTTTTGAGCCTGCAGCTGTGTAGAGCTTGTTTGCT
 
. : . : . : . : . : . :
JMFF049J23+ GCTGTGAGCCCAGCCATTCCTGCTCCAATTATCACAACTTTTGGTTTCTTGCTCACCATC
JMSF011H07+ GCTGTGAGCCCAGCCATTCCTGCTCCAATTATCACAACTTTTGGTTTCTTGCTCACCATC
JMSF013G18+ GCTGTGAGCCCAGCCATTCCTGCTCCAATTATCACAACTTTTGGTTTCTTGCTCACCATC
                      ____________________________________________________________
consensus GCTGTGAGCCCAGCCATTCCTGCTCCAATTATCACAACTTTTGGTTTCTTGCTCACCATC
 
. : . : . : . : . : . :
JMFF049J23+ TTCTTCTTTCCTCTTTTCTTTCTTTTTGGCTCTCTTGTGAGTTTCACTCAGACAAATGAC
JMSF011H07+ TTCTTCTTTCCTCTTTTCTTTCTTTTTGGCTCTCTTGTGAGTTTCACTCAGACAAATGAC
JMSF013G18+ TTCTTCTTTCCTCTTTTCTTTCTTTTTGGCTCTCTTGTGAGTTTCACTCAGACAAATGAC
                      ____________________________________________________________
consensus TTCTTCTTTCCTCTTTTCTTTCTTTTTGGCTCTCTTGTGAGTTTCACTCAGACAAATGAC
 
. : . : . : . : . : . :
JMFF049J23+ AGA
JMSF011H07+ AGAACACGTACAAGACAGAAAAAAGAGAAACAAATTTATGAGGAGAGGTGAGGTGAGTTT
JMSF013G18+ AGAACACGTACAAGACAGAAAAAAGAGAAACAAATTTATGAGGAGAGGTGAGGTGAGTTT
                      ____________________________________________________________
consensus AGAACACGTACAAGACAGAAAAAAGAGAAACAAATTTATGAGGAGAGGTGAGGTGAGTTT
 
. : . : . : . : . : . :
JMSF013G18+ GATTTACTCAACAAGTTTTCAAATATATAAGGAGTAACATCCTGCCTTTGCCTTAAACGA
                      ____________________________________________________________
consensus GATTTACTCAACAAGTTTTCAAATATATAAGGAGTAACATCCTGCCTTTGCCTTAAACGA
 
. : . : . : . : . : . :
JMSF013G18+ ATTCAATTTTTTCCCCATCTTATTCTACATTGTTTATCACTCTAATAAAGACATGCCTCC
                      ____________________________________________________________
consensus ATTCAATTTTTTCCCCATCTTATTCTACATTGTTTATCACTCTAATAAAGACATGCCTCC