Previous Contig 005401:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF013G13Sequence508005401 (5)gb:AP003294_18274994e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P069418005401 (5)
JMSF035E18Sequence511005401 (5)gb:AP003294_18274994e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P069515005401 (5)
JMSF038F04Sequence325005401 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF035E18- TGGTTTTTTTTTTTTTNCAAGGGAAATAANTAATAGNGGC
JMSF035E18+ TTTTTTTTTTATACAAAGGAAATAAATAATAGAGGC
JMSF013G13+ GGAAATAAATAATAGAGGC
                      ____________________________________________________________
consensus TGGTTTTTTTTTTTTTACAAGGGAAATAAATAATAGAGGC
 
. : . : . : . : . : . :
rJMSF035E18- AAANGANTTTTTGAAATAAANTTAACAATCAAAGGTCTACGGCTACCCANTTACNCCNTC
JMSF035E18+ AAATGAATTTTTGAAATAAAATTAACAATCAAATGTCTACTGCTACCCAATTACTCCATC
JMSF013G13+ AAATGAATTTTTGAAATAAAATTAACAATCAAATGTCTACTGCTACCCAATTACTCCATC
                      ____________________________________________________________
consensus AAATGAATTTTTGAAATAAAATTAACAATCAAATGTCTACTGCTACCCAATTACTCCATC
 
. : . : . : . : . : . :
rJMSF035E18- ANTTACAAACCNCCCTACNCNGTACAAACNCAGGTATTATATATATTTATATCNCNCAGG
JMSF035E18+ AATTACAAACCACCCTACACAGTACAAACACATGTATTATATATATTTATATCTCTCAGT
rJMSF013G13- TTACAAACCNCCCTACNCNGTACAAACNCANGTATTANATATATTTATATCNCNCAGG
JMSF013G13+ AATTACAAACCACCCTACACAGTACAAACACATGTATTATATATATTTATATCTCTCAGT
                      ____________________________________________________________
consensus AATTACAAACCACCCTACACAGTACAAACACATGTATTATATATATTTATATCTCTCAGT
 
. : . : . : . : . : . :
rJMSF035E18- GAANCAGGTAAGTAANCNCCANAGCTNCCAGCATCANAGCATANGCTATTCCTNGATCAA
JMSF035E18+ GAATCATGTAAGTAATCGCCAGAGCTACCAGCATCAGAGCATATGCTATTCCTTGATCAA
rJMSF013G13- GAATCAGGTAAGTAATCNCCANAGCTACCAGCATCANAGCATANGCTATTCCTNGATCAA
JMSF013G13+ GAATCATGTAAGTAATCGCCAGAGCTACCAGCATCAGAGCATATGCTATTCCTTGATCAA
                      ____________________________________________________________
consensus GAATCATGTAAGTAATCGCCAGAGCTACCAGCATCAGAGCATATGCTATTCCTTGATCAA
 
. : . : . : . : . : . :
rJMSF035E18- TNGCCNCCCCATCACTTGGGGGGGCAGGGGCAGGGGCCNGGGCNTTAANGGAAGGAATAN
JMSF035E18+ TTGCCACCCCATCACTTGTGGGGGCAGGGGCAGGGGCCTGGGCATTAATGGAAGGAATAG
JMSF038F04+ CCATCACTTGTGGGGGCAGGGGCAGGGGCCTGGGCATTAATGGAAGGAATAG
rJMSF013G13- TTGCCNCCCCATCACTTGNGGGGGCAGGGGCAGGGGCCNGGGCNTTAANGGAAGGAATAN
JMSF013G13+ TTGCCACCCCATCACTTGTGGGGGCAGGGGCAGGGGCCTGGGCATTAATGGAAGGAATAG
                      ____________________________________________________________
consensus TTGCCACCCCATCACTTGTGGGGGCAGGGGCAGGGGCCTGGGCATTAATGGAAGGAATAG
 
. : . : . : . : . : . :
rJMSF035E18- CCAANGCCAANACAATAGCAAAANCAGACTTTAANAANCAAACNCTNGAANCCNCCANAG
JMSF035E18+ CCAATGCCAAGACAATAGCAAAAACAGACATTAAGAAGCAAACTCTTGAAACCTCCATAG
JMSF038F04+ CCAATGCCAAGACAATAGCAAAAACAGACATTAAGAAGCAAACTCTTGAAACCTCCATAG
rJMSF013G13- CCAANGCCAANACAATANCAAAANCANACTTTAANAANCAAACTCTTGAANCCNCCATAG
JMSF013G13+ CCAATGCCAAGACAATAGCAAAAACAGACATTAAGAAGCAAACTCTTGAAACCTCCATAG
                      ____________________________________________________________
consensus CCAATGCCAAGACAATAGCAAAAACAGACATTAAGAAGCAAACTCTTGAAACCTCCATAG
 
. : . : . : . : . : . :
rJMSF035E18- TTGCNGCTATAACNCCTTCAAAGCTTCANCCNCNCAAATTTTCTNGATTTCNATCTTCAA
JMSF035E18+ TTGCTGCTATAACACCTTCAAAGCTTCAACCACTCAAATTTTCTTGATTTCTATCTTCAA
JMSF038F04+ TTGCTGCTATAACACCTTCAAAGCTTCAACCACTCAAATTTTCTTGATTTCTATCTTCAA
rJMSF013G13- TTGCNGCTATAACNCCTTCAAAGCTTCAACCNCNCAAATTTTCTNGATTTCNATCTTCAA
JMSF013G13+ TTGCTGCTATAACACCTTCAAAGCTTCAACCACTCAAATTTTCTTGATTTCTATCTTCAA
                      ____________________________________________________________
consensus TTGCTGCTATAACACCTTCAAAGCTTCAACCACTCAAATTTTCTTGATTTCTATCTTCAA
 
. : . : . : . : . : . :
rJMSF035E18- GGGCNGCTTGACATAANCCTNGATNGTATACTTAAANCCCNGAAATTGTNGGGCTATNTA
JMSF035E18+ TGGCTGCTTGACATAAGCCTTGATTGTATACTTAAATCCCTGAAATTGTTGGGCTATATA
JMSF038F04+ TGGCTGCTTGACATAAGCCTTGATTGTATACTTAAATCCCTGAAATTGTTGGGCTATATA
rJMSF013G13- GGGCNGCTTGACATAANCCTNGATNGTATACTTAAANCCCNGAAATTGTNGGGCTATNTA
JMSF013G13+ TGGCTGCTTGACATAAGCCTTGATTGTATACTTAAATCCCTGAAATTGTTGGGCTATATA
                      ____________________________________________________________
consensus TGGCTGCTTGACATAAGCCTTGATTGTATACTTAAATCCCTGAAATTGTTGGGCTATATA
 
. : . : . : . : . : . :
rJMSF035E18- AAGAAGGGCANAGAGAGAGAGAANATTATTCNGGGTTTGATTGAAAGGA
JMSF035E18+ AAGAAAGGCAGAGAGAGAGAGAAGATTATTCTGGGTTTGATTGAGAGGATC
JMSF038F04+ AAGAAAGGCAGAGAGAGAGAGAAGATTATTCTGGGTTTGATTGAGAGGATC
rJMSF013G13- AAGAAGGGCANAGAGAGAGAGAAAATTATTCNGGGTTTGATTGAAAGGATC
JMSF013G13+ AAGAAAGGCAGAGAGAGAGAGAAGATTATTCTGGGTTTGATTGAGAGGATCTCCAGAGCT
                      ____________________________________________________________
consensus AAGAAAGGCAGAGAGAGAGAGAAGATTATTCTGGGTTTGATTGAGAGGATCTCCAGAGCT