Previous Contig 005387:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043F12Sequence646005387 (3)gb:AY085374_15704442e-43Arabidopsis thaliana clone 148454 mRNA, complete sequence.635010301 (4)gb:AY085374_15704443e-12Arabidopsis thaliana clone 148454 mRNA, complete sequence.
JMSF001H06Sequence383005387 (3)gb:AY085374_15704442e-16Arabidopsis thaliana clone 148454 mRNA, complete sequence.340010301 (4)
JMSF013D22Sequence111005387 (3)666010301 (4)gb:AY085374_15704445e-23Arabidopsis thaliana clone 148454 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF043F12+ CAGCAAGGTG
                      ____________________________________________________________
consensus CAGCAAGGTG
 
. : . : . : . : . : . :
JMFF043F12+ CAATGGAGTCATCCCATTATTTGCTCTGGCTTCAACAAGAGCACCATGAGAGAGAAGTAA
                      ____________________________________________________________
consensus CAATGGAGTCATCCCATTATTTGCTCTGGCTTCAACAAGAGCACCATGAGAGAGAAGTAA
 
. : . : . : . : . : . :
JMFF043F12+ CTTTGCAGCTTCATTACATCCATTCTTAGCAGCCATATGCAATGGGGTCTCCCCATACAT
                      ____________________________________________________________
consensus CTTTGCAGCTTCATTACATCCATTCTTAGCAGCCATATGCAATGGGGTCTCCCCATACAT
 
. : . : . : . : . : . :
JMSF001H06+ AGCAATAGTTTAACAAT
JMFF043F12+ GTTCTTTGCTTCCAACTCCACCTTTTCTGGGCCTTGGAAACCAAGCAATAGTTTAACAAT
                      ____________________________________________________________
consensus GTTCTTTGCTTCCAACTCCACCTTTTCTGGGCCTTGGAAACCAAGCAATAGTTTAACAAT
 
. : . : . : . : . : . :
JMSF001H06+ CTCAATATTATTGTAACCAGCAGAAACATGAAGTGGTGTCTGTGCCATAACGGGGTTACG
JMFF043F12+ CTCAATATTATTGTAACCAGCAGAAACATGAAGTGGTGTCTGTGCCATAACGGGGTTACG
                      ____________________________________________________________
consensus CTCAATATTATTGTAACCAGCAGAAACATGAAGTGGTGTCTGTGCCATAACGGGGTTACG
 
. : . : . : . : . : . :
JMSF001H06+ TTCATTGAGGAGAGAAGGGTTGTCATTAAGCATCTTGTGGAAGGCATTGAGATCCCCAGA
JMFF043F12+ TTCATTGAGGAGAGAAGGGTTGTCATTAAGCATCTTGTGGAAGGCATTGAGATCCCCAGA
                      ____________________________________________________________
consensus TTCATTGAGGAGAGAAGGGTTGTCATTAAGCATCTTGTGGAAGGCATTGAGATCCCCAGA
 
. : . : . : . : . : . :
JMSF001H06+ TTGAGCAAACCCATGGATTGTCGTGGGTCTGGAAGACTTTGACCTCTGATCCCTAACCTT
JMFF043F12+ TTGAGCAAACCCATGGATTGTCGTGGGTCTGGAAGACTTTGACCTCTGATCCCTAACCTT
                      ____________________________________________________________
consensus TTGAGCAAACCCATGGATTGTCGTGGGTCTGGAAGACTTTGACCTCTGATCCCTAACCTT
 
. : . : . : . : . : . :
JMSF001H06+ ATGCATTATTTTCCTTGTTTCCTATTAGCGTCTTCTCCCCCAATGAAAAATCAACAAAAG
JMFF043F12+ ATGCATTATTTTCCTTGTTTCCTATTAGCGTCTTCTCCCCCAATGAAAAATCAACAAAAG
                      ____________________________________________________________
consensus ATGCATTATTTTCCTTGTTTCCTATTAGCGTCTTCTCCCCCAATGAAAAATCAACAAAAG
 
. : . : . : . : . : . :
JMSF001H06+ CAAGAATGGAGGCCTTGCCGACAGAGGTTTAAGCGGCGTTTCTGGGGGAAGGGTGGCCGG
JMFF043F12+ CAAGAATGGAGGCCTTGCCGACAGAGGTTTAAGCGGCGTTTCTGGGGGAAGGGTGGCCGG
                      ____________________________________________________________
consensus CAAGAATGGAGGCCTTGCCGACAGAGGTTTAAGCGGCGTTTCTGGGGGAAGGGTGGCCGG
 
. : . : . : . : . : . :
JMSF001H06+ ACGGTGGAATTGGGGGTTGTCAGTTGTCAGAGGAATTTCGTCAAACAAGTCATGGGTGGT
JMFF043F12+ ACGGTGGAATTGGGGGTTGTCAGTTGTCAGAGGAATTTCGTCAAACAAGTCATGGGTGGT
                      ____________________________________________________________
consensus ACGGTGGAATTGGGGGTTGTCAGTTGTCAGAGGAATTTCGTCAAACAAGTCATGGGTGGT
 
. : . : . : . : . : . :
JMSF001H06+ CAGG
JMFF043F12+ CAGGCGAGTGTGGAAATGAAATGAAAAGAAAATAAAAGAAATGGAAGAAAGGAGAAAAAA
JMSF013D22+ GTGGAAATGAAATGAAAAGAAAATNAAAGAAATGGNAGAAAGGGGAAAAAA
                      ____________________________________________________________
consensus CAGGCGAGTGTGGAAATGAAATGAAAAGAAAATAAAAGAAATGGAAGAAAGGGGAAAAAA
 
. : . : . : . : . : . :
JMFF043F12+ AAAAAGGGAAATTTCTTCGGTTGCCTGGCCTTG
JMSF013D22+ AAAAAGGGAAATTTCTTCGGTTGCCTGGCCTTGGCTGGCTGCCAATTGCTTGCCAGCTTG
                      ____________________________________________________________
consensus AAAAAGGGAAATTTCTTCGGTTGCCTGGCCTTGGCTGGCTGCCAATTGCTTGCCAGCTTG