Previous Contig 005385:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF013D14Sequence381005385 (4)gb:AP004363_18407792e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P001723011731 (4)gb:BT002413_16360164e-39Arabidopsis thaliana GPAA1 - like protein (At5g19130) mRNA, complete cds.
JMSF027M14Sequence679005385 (4)gb:AP004363_18407798e-48Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P001722011731 (4)gb:BT002413_16360164e-39Arabidopsis thaliana GPAA1 - like protein (At5g19130) mRNA, complete cds.
JMSF028E17Sequence650005385 (4)gb:BT002413_16360163e-44Arabidopsis thaliana GPAA1 - like protein (At5g19130) mRNA, complete cds.694011731 (4)gb:BT002413_16360164e-39Arabidopsis thaliana GPAA1 - like protein (At5g19130) mRNA, complete cds.
JMSF037P16Sequence679005385 (4)gb:AP004363_18407796e-48Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P001691011731 (4)gb:BT002413_16360164e-39Arabidopsis thaliana GPAA1 - like protein (At5g19130) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037P16+ CACGNAGCAACTGCAGCATAATCCCCAAGCTGGGAATCCGCAGCAAGCCATAT
JMSF028E17+ ATCCGCAGCAAGCCATAT
JMSF027M14+ GCAACTGCAGCATAATCCCCAAGCTGGGAATCCGCAGCAAGCCATAT
                      ____________________________________________________________
consensus CACGNAGCAACTGCAGCATAATCCCCAAGCTGGGAATCCGCAGCAAGCCATAT
 
. : . : . : . : . : . :
JMSF037P16+ AATATCTTTGGCTAACCAAGTGACTCGAGTAAGCAGAGAGAACACTGAGTATCCAATGCC
JMSF028E17+ AATATCTTTGGCTAACCAAGTGACTCGAGTAAGCAGAGAGAACACTGAGTATCCAATGCC
JMSF027M14+ AATATCTTTGGCTAACCAAGTGACTCGAGTAAGCAGAGAGAACACTGAGTATCCAATGCC
                      ____________________________________________________________
consensus AATATCTTTGGCTAACCAAGTGACTCGAGTAAGCAGAGAGAACACTGAGTATCCAATGCC
 
. : . : . : . : . : . :
JMSF037P16+ TAGAGATAAAGCCTCACCCGCAGTGACCTTCATAGAATTATAAGGTGTCACCAGTACAAT
JMSF028E17+ TAGAGATAAAGCCTCACCCGCAGTGACCTTCATAGAATTATAAGGTGTCACCAGTACAAT
JMSF027M14+ TAGAGATAAAGCCTCACCCGCAGTGACCTTCATAGAATTATAAGGTGTCACCAGTACAAT
                      ____________________________________________________________
consensus TAGAGATAAAGCCTCACCCGCAGTGACCTTCATAGAATTATAAGGTGTCACCAGTACAAT
 
. : . : . : . : . : . :
JMSF037P16+ AGCTTCCTTTCCATCACCACGTGGAGCTCTAATTATTCCAACTGTATTGATACCATATGT
JMSF028E17+ AGCTTCCTTTCCATCACCACGTGGAGCTCTAATTATTCCAACTGTATTGATACCATATGT
JMSF027M14+ AGCTTCCTTTCCATCACCACGTGGAGCTCTAATTATTCCAACTGTATTGATACCATATGT
                      ____________________________________________________________
consensus AGCTTCCTTTCCATCACCACGTGGAGCTCTAATTATTCCAACTGTATTGATACCATATGT
 
. : . : . : . : . : . :
JMSF037P16+ TGAACAGCTGTAGTTCTCTTGAACTATTTCAGGATCAGGACTAGAAAAGAAACGCAACGG
JMSF028E17+ TGAACAGCTGTAGTTCTCTTGAACTATTTCAGGATCAGGACTAGAAAAGAAACGCAACGG
JMSF027M14+ TGAACAGCTGTAGTTCTCTTGAACTATTTCAGGATCAGGACTAGAAAAGAAACGCAACGG
                      ____________________________________________________________
consensus TGAACAGCTGTAGTTCTCTTGAACTATTTCAGGATCAGGACTAGAAAAGAAACGCAACGG
 
. : . : . : . : . : . :
JMSF037P16+ TTGAAACTTATTCACTTGAGGCTGGAATTTGTGAAAATTTACTTCACCACCCAAATCCTT
JMSF028E17+ TTGAAACTTATTCACTTGAGGCTGGAATTTGTGAAAATTTACTTCACCACCCAAATCCTT
JMSF027M14+ TTGAAACTTATTCACTTGAGGCTGGAATTTGTGAAAATTTACTTCACCACCCAAATCCTT
JMSF013D14+ TACTTCACCACCCAAATCCTT
                      ____________________________________________________________
consensus TTGAAACTTATTCACTTGAGGCTGGAATTTGTGAAAATTTACTTCACCACCCAAATCCTT
 
. : . : . : . : . : . :
JMSF037P16+ AATGTGCTGTGCGATTATTCCTGGAATACCTATGCCTGAGCCAGCTGATCCTGAATTGAA
JMSF028E17+ AATGTGCTGTGCGATTATTCCTGGAATACCTATGCCTGAGCCAGCTGATCCTGAATTGAA
JMSF027M14+ AATGTGCTGTGCGATTATTCCTGGAATACCTATGCCTGAGCCAGCTGATCCTGAATTGAA
JMSF013D14+ AATGTGCTGTGCGATTATTCCTGGAATACCTATGCCTGAGCCAGCTGATCCTGAATTGAA
                      ____________________________________________________________
consensus AATGTGCTGTGCGATTATTCCTGGAATACCTATGCCTGAGCCAGCTGATCCTGAATTGAA
 
. : . : . : . : . : . :
JMSF037P16+ GCTGAGTATATTGTTCACAAATCTACTGGCCTGTGAAACATCATCATGTGAAAGCATTGG
JMSF028E17+ GCTGAGTATATTGTTCACAAATCTACTGGCCTGTGAAACATCATCATGTGAAAGCATTGG
JMSF027M14+ GCTGAGTATATTGTTCACAAATCTACTGGCCTGTGAAACATCATCATGTGAAAGCATTGG
JMSF013D14+ GCTGAGTATATTGTTCACAAATCTACTGGCCTGTGAAACATCATCATGTGAAAGCATTGG
                      ____________________________________________________________
consensus GCTGAGTATATTGTTCACAAATCTACTGGCCTGTGAAACATCATCATGTGAAAGCATTGG
 
. : . : . : . : . : . :
JMSF037P16+ ACTAGCAGAACCAGGCATGAGCGCATTTTCGGAAATGTAAGTGTTCTTAGCGAGAACTGG
JMSF028E17+ ACTAGCAGAACCAGGCATGAGCGCATTTTCGGAAATGTAAGTGTTCTTAGCGAGAACTGG
JMSF027M14+ ACTAGCAGAACCAGGCATGAGCGCATTTTCGGAAATGTAAGTGTTCTTAGCGAGAACTGG
JMSF013D14+ ACTAGCAGAACCAGGCATGAGCGCATTTTCGGAAATGTAAGTGTTCTTAGCGAGAACTGG
                      ____________________________________________________________
consensus ACTAGCAGAACCAGGCATGAGCGCATTTTCGGAAATGTAAGTGTTCTTAGCGAGAACTGG
 
. : . : . : . : . : . :
JMSF037P16+ TAAGAGCAATAGCGCCAAAACCCCCGCTGTACAGCACACAACGCTGACGAGGAGGCTGTG
JMSF028E17+ TAAGAGCAATAGCGCCAAAACCCCCGCTGTACAGCACACAACGCTGACGAGGAGGCTGTG
JMSF027M14+ TAAGAGCAATAGCGCCAAAACCCCCGCTGTACAGCACACAACGCTGACGAGGAGGCTGTG
JMSF013D14+ TAAGAGCAATAGCGCCAAAACCCCCGCTGTACAGCACACAACGCTGACGAGGAGGCTGTG
                      ____________________________________________________________
consensus TAAGAGCAATAGCGCCAAAACCCCCGCTGTACAGCACACAACGCTGACGAGGAGGCTGTG
 
. : . : . : . : . : . :
JMSF037P16+ AGAAACAAGAAGAAGGCCGATGCGGATGATAGGTCGAGGCCTCGGCTTCGTAGGATCGAT
JMSF028E17+ AGAAACAAGAAGAAGGCCGATGCGGATGATAGGTCGAGGCCTCGGCTTCGTAGGATCGAT
JMSF027M14+ AGAAACAAGAAGAAGGCCGATGCGGATGATAGGTCGAGGCCTCGGCTTCGTAGGATCGAT
JMSF013D14+ AGAAACAAGAAGAAGGCCGATGCGGATGATAGGTCGAGGCCTCGGCTTCGTAGGATCGAT
                      ____________________________________________________________
consensus AGAAACAAGAAGAAGGCCGATGCGGATGATAGGTCGAGGCCTCGGCTTCGTAGGATCGAT
 
. : . : . : . : . : . :
JMSF037P16+ TTCCGCCATGGCATCAACCGCCG
JMSF028E17+ TTCCGCCATGGCATCAACCGCCG
JMSF027M14+ TTCCGCCATGGCATCAACCGCCG
JMSF013D14+ TTCCGCCATGGCATCAACCGCCGATAAGGCCGATTGGATCGGCTTCTTCAGTTCCCTTCC
                      ____________________________________________________________
consensus TTCCGCCATGGCATCAACCGCCGATAAGGCCGATTGGATCGGCTTCTTCAGTTCCCTTCC