Previous Contig 005384:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009E04Sequence544005384 (3)gb:AC120983_17399650.017Oryza sativa chromosome 3 BAC OSJNBb0011H13 genomic sequence, complete sequence.672010468 (3)pir|E84617|E846173e-26hypothetical protein At2g22840 [imported] - Arabidopsis thaliana>gb:AC004786_153
JMFF044N15Sequence650005384 (3)gb:AC120983_17399655e-16Oryza sativa chromosome 3 BAC OSJNBb0011H13 genomic sequence, complete sequence.567010468 (3)gb:AB102903_15263507e-22Solanum melongena 5D09 mRNA for hypothetical protein, partial cds.
JMSF013D13Sequence401005384 (3)745010468 (3)pir|E84617|E846173e-26hypothetical protein At2g22840 [imported] - Arabidopsis thaliana>gb:AC004786_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF044N15+ TAGGGGTTTAGCGATTTCATGAGGGGAATGAGGAGATTAGAA
                      ____________________________________________________________
consensus TAGGGGTTTAGCGATTTCATGAGGGGAATGAGGAGATTAGAA
 
. : . : . : . : . : . :
JMFF044N15+ GGAATTGGAACATTTGCCACCATGTGCTTGTAGATCAAGGCCTGATGTTCCAGTTCCATC
                      ____________________________________________________________
consensus GGAATTGGAACATTTGCCACCATGTGCTTGTAGATCAAGGCCTGATGTTCCAGTTCCATC
 
. : . : . : . : . : . :
JMFF009E04+ ACTGTGATGGAGTGAATGGTCCACTGATCCGAGCAGAACCCCCCCTTAAGCTTTCATTC
JMFF044N15+ CACTGTGATGGAGTGAATGGTCCACTGATCCGAGCAGAACCCCCCCTTAAGCTTTCATTC
                      ____________________________________________________________
consensus CACTGTGATGGAGTGAATGGTCCACTGATCCGAGCAGAACCCCCCCTTAAGCTTTCATTC
 
. : . : . : . : . : . :
JMFF009E04+ AAACCTCCAATTGCGTAAGCTGAAGCGGCGCCAGAATGGGGACCGCGTTTCTGGTGGGAC
JMFF044N15+ AAACCTCCAATTGCGTAAGCTGAAGCGGCGCCAGAATGGGGACCGCGTTTCTGGTGGGAC
                      ____________________________________________________________
consensus AAACCTCCAATTGCGTAAGCTGAAGCGGCGCCAGAATGGGGACCGCGTTTCTGGTGGGAC
 
. : . : . : . : . : . :
JMFF009E04+ TCGAAAAGCGGAAAACAAATGGTTTTAGATGAATCTTCCCCGGCAGGCGCAGAAGAAAGA
JMFF044N15+ TCGAAAAGCGGAAAACAAATGGTTTTAGATGAATCTTCCCCGGCAGGCGCAGAAGAAAGA
                      ____________________________________________________________
consensus TCGAAAAGCGGAAAACAAATGGTTTTAGATGAATCTTCCCCGGCAGGCGCAGAAGAAAGA
 
. : . : . : . : . : . :
JMFF009E04+ AAGGGGATTTCTTCAGACTTGGAGGAGGAGAAACTAAGCATGGTGGCTTTTCCAGGCACG
JMFF044N15+ AAGGGGATTTCTTCAGACTTGGAGGAGGAGAAACTAAGCATGGTGGCTTTTCCAGGCACG
                      ____________________________________________________________
consensus AAGGGGATTTCTTCAGACTTGGAGGAGGAGAAACTAAGCATGGTGGCTTTTCCAGGCACG
 
. : . : . : . : . : . :
JMFF009E04+ CTGTCCGCAGATCTCCATAAAAAGCTGGGAACTTTAGAAGGCGCTGCTGCGGATCTTTCT
JMFF044N15+ CTGTCCGCAGATCTCCATAAAAAGCTGGGAACTTTAGAAGGCGCTGCTGCGGATCTTTCT
JMSF013D13+ AAAAGCTGGGAACTTTAGAAGGCGCTGCTGCGGATCTTTCT
                      ____________________________________________________________
consensus CTGTCCGCAGATCTCCATAAAAAGCTGGGAACTTTAGAAGGCGCTGCTGCGGATCTTTCT
 
. : . : . : . : . : . :
JMFF009E04+ TGCTTTGGGTGGCCAGATCCATGGGTGTCGCCGCCGCCTGGGGGTTCATCAGGGTGTTGC
JMFF044N15+ TGCTTTGGGTGGCCAGATCCATGGGTGTCGCCGCCGCCTGGGGGTTCATCAGGGTGTTGC
JMSF013D13+ TGCTTTGGGTGGCCAGATCCATGGGTGTCGCCGCCGCCTGGGGGTTCATCAGGGTGTTGC
                      ____________________________________________________________
consensus TGCTTTGGGTGGCCAGATCCATGGGTGTCGCCGCCGCCTGGGGGTTCATCAGGGTGTTGC
 
. : . : . : . : . : . :
JMFF009E04+ CGGGTGGTGCCCGCCGTTCCGGCCGCCGCCATTAACCCGAAACCCATTCTTGAAAGGGGA
JMFF044N15+ CGGGTGGTGCCCGCCGTTCCGGCCGCCGCCATTAACCCGAAATCCATTCTTGAAAGGGGA
JMSF013D13+ CGGGTGGTGCCCGCCGTTCCGGCCGCCGCCATTAACCCGAAATCCATTCTTGAAAGGGGA
                      ____________________________________________________________
consensus CGGGTGGTGCCCGCCGTTCCGGCCGCCGCCATTAACCCGAAATCCATTCTTGAAAGGGGA
 
. : . : . : . : . : . :
JMFF009E04+ ATCTAGGAGGCGTTTGCACAGCATGAGTTCATTGCATTTGCAGGCAGCTAGCAGAAGTGA
JMFF044N15+ ATCTAGGAGGCGTTTGCACAGCATGAGTTCATTGCATTTGCAGGCAGCTAGCAGAAGTGA
JMSF013D13+ ATCTAGGAGGCGTTTGCACAGCATGAGTTCATTGCATTTGCAGGCAGCTAGCAGAAGTGA
                      ____________________________________________________________
consensus ATCTAGGAGGCGTTTGCACAGCATGAGTTCATTGCATTTGCAGGCAGCTAGCAGAAGTGA
 
. : . : . : . : . : . :
JMFF009E04+ ACTAAGCCAGAGTGAGAGTAAAAAGAAAGAAATTAAACAGTGGAATGGTTGTCACTTGTG
JMFF044N15+ ACTAAGCCAGAGTGAGAGTAAAAAGAAAGAAATTAAACAGTGGAATGGTTGTCACTTGTG
JMSF013D13+ ACTAAGCCAGAGTGAGAGTAAAAAGAAAGAAATTAAACAGTGGAATGGTTGTCACTTGTG
                      ____________________________________________________________
consensus ACTAAGCCAGAGTGAGAGTAAAAAGAAAGAAATTAAACAGTGGAATGGTTGTCACTTGTG
 
. : . : . : . : . : . :
JMFF009E04+ GTTAC
JMFF044N15+ GTTAC
JMSF013D13+ GTTACAAGTTTGGGGGAGAAGGAAGCGGACAAAGAAACTACAGTAGCAAAGTGCAAACTG
                      ____________________________________________________________
consensus GTTACAAGTTTGGGGGAGAAGGAAGCGGACAAAGAAACTACAGTAGCAAAGTGCAAACTG
 
. : . : . : . : . : . :
JMSF013D13+ CAAACAGACTGTCTCTCTCCACGTCTCGGACAAAGGGACATGTTAGACCGAGCTTATCTC
                      ____________________________________________________________
consensus CAAACAGACTGTCTCTCTCCACGTCTCGGACAAAGGGACATGTTAGACCGAGCTTATCTC