Previous Contig 005377:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS015A12Sequence554005377 (6)gb:NTA496227_16914200.002Nicotiana tabacum partial mRNA for putative rac protein (rac3 gene).
JMFS017C01Sequence617005377 (6)gb:NTA496227_16914200.002Nicotiana tabacum partial mRNA for putative rac protein (rac3 gene).
JMFS102E12Sequence612005377 (6)gb:NTA496227_16914200.002Nicotiana tabacum partial mRNA for putative rac protein (rac3 gene).
JMFS103D10Sequence586005377 (6)gb:NTA496227_16914200.002Nicotiana tabacum partial mRNA for putative rac protein (rac3 gene).
JMSF013C07Sequence456005377 (6)gb:NTA496227_16914200.015Nicotiana tabacum partial mRNA for putative rac protein (rac3 gene).720012592 (4)pir|T05645|T056457e-31hypothetical protein F20D10.300 - Arabidopsis thaliana>gb:ATCHRIV89_1547772 Arab
JMSF019E04Sequence258005377 (6)687012592 (4)pir|T05645|T056457e-44hypothetical protein F20D10.300 - Arabidopsis thaliana>gb:ATCHRIV89_1547772 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS103D10+ CAAATTCCATGCCCTCGAAAGGTTCAAGATCGAGGTCGCCAGTTGGAGTGTATATC
                      ____________________________________________________________
consensus CAAATTCCATGCCCTCGAAAGGTTCAAGATCGAGGTCGCCAGTTGGAGTGTATATC
 
. : . : . : . : . : . :
JMFS103D10+ CCACTGACAATAAGAGCATCACTACTATGTGCAGGAGAGCAGTTAGGCATGGTTTCAGCA
JMFS102E12+ CAATAAGAGCATCACTACTATGTGCAGGAGAGCAGTTAGGCATGGTTTCAGCA
JMFS017C01+ GTTTCAGCA
                      ____________________________________________________________
consensus CCACTGACAATAAGAGCATCACTACTATGTGCAGGAGAGCAGTTAGGCATGGTTTCAGCA
 
. : . : . : . : . : . :
JMFS103D10+ TCGTCCATATTTTCTAGAATAACATCCCCATCTCCATCTTCGCTCCCGCCTCCACCTCTG
JMFS102E12+ TCGTCCATATTTTCTAGAATAACATCCCCATCTCCATCTTCGCTCCCGCCTCCACCTCTG
JMFS015A12+ AGAATAACATCCCCATCTCCATCTTCGCTCCCGCCTCCACCTCTG
JMFS017C01+ TCGTCCATATTTTCTAGAATAACATCCCCATCTCCATCTTCGCTCCCGCCTCCACCTNTG
                      ____________________________________________________________
consensus TCGTCCATATTTTCTAGAATAACATCCCCATCTCCATCTTCGCTCCCGCCTCCACCTCTG
 
. : . : . : . : . : . :
JMFS103D10+ ATGCCAATATCAAACTCAATTACTTGATTCTCCATCTTCACAAAGAAATTCAGTCTACAG
JMFS102E12+ ATGCCAATATCAAACTCAATTACTTGATTCTCCATCTTCACAAAGAAATTCAGTCTACAG
JMFS015A12+ ATGACAATATCAAACTCAATTACTTGATTCTCCATCTTCACAAAGAAATTCAGTCTACAG
JMFS017C01+ ATGCCAATATCAAACTCAATTACTTGATTCTCCATCTTCACAAAGAAATTCAGTCTACAG
                      ____________________________________________________________
consensus ATGCCAATATCAAACTCAATTACTTGATTCTCCATCTTCACAAAGAAATTCAGTCTACAG
 
. : . : . : . : . : . :
JMFS103D10+ AACAGCGTTCTGCTTTTGTCTATTAAATATGAAGGTTCCTCTATGGCAAGCCAACTACCA
JMFS102E12+ AACAGCGTTCTGCTTTTGTCTATTAAATATGAAGGTTCCTCTATGGCAAGCCAACTACCA
JMFS015A12+ AACAGCGTTC---TTTTGTCTATTAAATATGAAGGTTCCTCTATGGCAAGCCAACTACCA
JMFS017C01+ AACAGCGTTC---TTTTGTCTATTAAATATGAAGGTTCCTCTATGGCAAGCCAACTACCA
                      ____________________________________________________________
consensus AACAGCGTTCTGCTTTTGTCTATTAAATATGAAGGTTCCTCTATGGCAAGCCAACTACCA
 
. : . : . : . : . : . :
JMFS103D10+ AACTTTAGTGTACAAGATCTTTTTTGAGATGTTTTCAAACCTAGGCCTACTTATGAGAGA
JMFS102E12+ AACTTTAGTGTACAAGATCTTTTTTGAGATGTTTTCAAACCTAGGCCTACTTATGAGAGA
JMFS015A12+ AACTTTAGTGTACAAGATCTTTTTTGAGATGTTTTCAAACCTAGGCCTACTTATGAGAGA
JMFS017C01+ AACTTTAGTGTACAAGATCTTTTTTGAGATGTTTTCAAACCTAGGCCTACTTATGAGAGA
JMSF013C07+ TGAGATGTTTTCAAACCTAGGCCTACTTATGAGAGA
                      ____________________________________________________________
consensus AACTTTAGTGTACAAGATCTTTTTTGAGATGTTTTCAAACCTAGGCCTACTTATGAGAGA
 
. : . : . : . : . : . :
JMFS103D10+ GATGCAAGGAGGAAGACATCAGCTCCTCCATAGCTAAGGGATCTAAGCTCGTTATAGTCC
JMFS102E12+ GATGCAAGGAGGAAGACATCAGCTCCTCCATAGCTAAGGGATCTAAGCTCGTTATAGTCC
JMFS015A12+ GATGCAAGGAGGAAGACATCAGCTCCTCCATAGCTAAGGGATCTAAGCTCGTTATAGTCC
JMFS017C01+ GATGCAAGGAGGAAGACATCAGCTCCTCCATAGCTAAGGGATCTAAGCTCGTTATAGTCC
JMSF013C07+ GATGCAAGGAGGAAGACATCAGCTCCTCCATAGCTAAGGGATCTAAGCTCGTTATAGTCC
                      ____________________________________________________________
consensus GATGCAAGGAGGAAGACATCAGCTCCTCCATAGCTAAGGGATCTAAGCTCGTTATAGTCC
 
. : . : . : . : . : . :
JMFS103D10+ TCTCGTCCTAAATCACTACTACAGAATAGCATGGGCTACTCGGCTAGTACTCCGAGCCAA
JMFS102E12+ TCTCGTCCTAAATCACTACTACAGAATAGCATGGGCTACTCGGCTAGTACTCCGAGCCAA
JMFS015A12+ TCTCGTCCTAAATCACTACTACAGAATAGCATGGGCTACTCGGCTAGTACTCCGAGCCAA
JMSF019E04+ CGAGCCAN
JMFS017C01+ TCTCGTCCTAAATCACTACTACAGAATAGCATGGGCTACTCGGCTAGTACTCCGAGCCAA
JMSF013C07+ TCTCGTCCTAAATCACTACTACAGAATAGCATGGGCTACTCGGCTAGTACTCCGAGCCAA
                      ____________________________________________________________
consensus TCTCGTCCTAAATCACTACTACAGAATAGCATGGGCTACTCGGCTAGTACTCCGAGCCAA
 
. : . : . : . : . : . :
JMFS103D10+ CAAACGGAAGCAAACGAGCACTTAAAATTGTTCTTTTACGGAATATACTTGAGAGCAACT
JMFS102E12+ CAAACGGAAGCAAACGAGCACTTAAAATTGTTCTTTTACGGAATATACTTGAGAGCAACT
JMFS015A12+ CAAACGGAAGCAAACGAGCACTTAAAATTGTTCTTTTACGGAATATACTTGAGAGCAACT
JMSF019E04+ CAAACGGAAGCAAACGAGCACTTAAAATTGTTCTTTTACGGAATATACTTGAGAGCAACT
JMFS017C01+ CAAACGGAAGCAAACGAGCACTTAAAATTGTTCTTTTACGGAATATACTTGAGAGCAACT
JMSF013C07+ CAAACGGAAGCAAACGAGCACTTAAAATTGTTCTTTTACGGAATATACTTGAGAGCAACT
                      ____________________________________________________________
consensus CAAACGGAAGCAAACGAGCACTTAAAATTGTTCTTTTACGGAATATACTTGAGAGCAACT
 
. : . : . : . : . : . :
JMFS103D10+ TTTATGAATGGGTGATTTTGTCATCCCCTCTGGCTCAAAACCCTAGCAAA
JMFS102E12+ TTTATGAATGGGTGATTTTGTCATCCCCTCTGGCTCAAAACCCTAGCAAAGAGATTATAG
JMFS015A12+ TTTATGAATGGGTGATTTTGTCATCCCCTCTGGCTCAAAACCCTAGCAAAGAGATTATAG
JMSF019E04+ TTTATGAATGGGTGATTTTGTCATCCCCTCTGGCTCAAAACCCTAGCAAAGAGATTATAG
JMFS017C01+ TTTATGAATGGGTGATTTTGTCATCCCCTCTGGCTCAAAACCCTAGCAAAGAGATTATAG
JMSF013C07+ TTTATGAATGGGTGATTTTGTCATCCCCTCTGGCTCAAAACCCTAGCAAAGAGATTATAG
                      ____________________________________________________________
consensus TTTATGAATGGGTGATTTTGTCATCCCCTCTGGCTCAAAACCCTAGCAAAGAGATTATAG
 
. : . : . : . : . : . :
JMFS102E12+ AGTGGAGCGGAGATCTTTGAGACTACGAGTGAAACAAAATGAATTCAAGAAAAGAGGGAG
JMFS015A12+ AGTGGAGCGGAGATCTTTGAGACTACGAGTGAAACAAAATGAATTCAAGAAAAGAGGGAG
JMSF019E04+ AGTGGAGCGGAGATCTTTGAGACTACGAGTGAAACAAAATGAATTCAAGAAAAGAGGGAG
JMFS017C01+ AGTGGAGCGGAGATCTTTGAGACTACGAGTGAAACAAAATGAATTCAAGAAAAGAGGGAG
JMSF013C07+ AGTGGAGCGGAGATCTTTGAGACTACGAGTGAAACAAAATGAATTCAAGAAAAGAGGGAG
                      ____________________________________________________________
consensus AGTGGAGCGGAGATCTTTGAGACTACGAGTGAAACAAAATGAATTCAAGAAAAGAGGGAG
 
. : . : . : . : . : . :
JMFS102E12+ TGGGGAGAGATGACCTGAG
JMFS015A12+ TGGGGAGAGATGACCTGAGTTCTTACAATGCA
JMSF019E04+ TGGGGAGAGATGACCTGAGTTCTTACAATGCACCGTAGCCGCCGAGAGAAGAGAGATGAT
JMFS017C01+ TGGGGAGAGATGACCTGAGTTCTTACAATGCACCGTAGCCGCCGAGAGAAGAGAGATGAT
JMSF013C07+ TGGGGAGAGATGACCTGAGTTCTTACAATGCACCGTAGCCGCCGAGAGAAGAGAGATGAT
                      ____________________________________________________________
consensus TGGGGAGAGATGACCTGAGTTCTTACAATGCACCGTAGCCGCCGAGAGAAGAGAGATGAT
 
. : . : . : . : . : . :
JMSF019E04+ GACTGATCT
JMFS017C01+ GACTGATCT
JMSF013C07+ GACTGATCTGTGGGACACGGAGCGAGTTCGTTAGACAACGAGCGAAAGGGCGGAGAGGCC
                      ____________________________________________________________
consensus GACTGATCTGTGGGACACGGAGCGAGTTCGTTAGACAACGAGCGAAAGGGCGGAGAGGCC