Previous Contig 005372:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002F23Sequence341005372 (9)gb:AY227203_15910576e-28Lotus corniculatus aldehyde dehydrogenase 1 precursor (Aldh1) mRNA, complete cds757012597 (9)gb:AY227203_15910573e-84Lotus corniculatus aldehyde dehydrogenase 1 precursor (Aldh1) mRNA, complete cds
JMSF013B20Sequence267005372 (9)792012597 (9)gb:AY227203_15910572e-84Lotus corniculatus aldehyde dehydrogenase 1 precursor (Aldh1) mRNA, complete cds
JMSF018P02Sequence375005372 (9)gb:AY227203_15910572e-27Lotus corniculatus aldehyde dehydrogenase 1 precursor (Aldh1) mRNA, complete cds737012597 (9)gb:AY227203_15910573e-98Lotus corniculatus aldehyde dehydrogenase 1 precursor (Aldh1) mRNA, complete cds
JMSF028A14Sequence681005372 (9)gb:AY227203_15910578e-90Lotus corniculatus aldehyde dehydrogenase 1 precursor (Aldh1) mRNA, complete cds789012597 (9)gb:AY227203_15910571e-91Lotus corniculatus aldehyde dehydrogenase 1 precursor (Aldh1) mRNA, complete cds
JMSF028F10Sequence683005372 (9)gb:AY227203_15910578e-90Lotus corniculatus aldehyde dehydrogenase 1 precursor (Aldh1) mRNA, complete cds791012597 (9)gb:AY227203_15910578e-91Lotus corniculatus aldehyde dehydrogenase 1 precursor (Aldh1) mRNA, complete cds
JMSF038P14Sequence678005372 (9)gb:AY227203_15910577e-86Lotus corniculatus aldehyde dehydrogenase 1 precursor (Aldh1) mRNA, complete cds851012597 (9)gb:AY227203_1591057e-114Lotus corniculatus aldehyde dehydrogenase 1 precursor (Aldh1) mRNA, complete cds
JMSF042L13Sequence740005372 (9)gb:AY227203_15910571e-95Lotus corniculatus aldehyde dehydrogenase 1 precursor (Aldh1) mRNA, complete cds841012597 (9)gb:AY227203_1591057e-112Lotus corniculatus aldehyde dehydrogenase 1 precursor (Aldh1) mRNA, complete cds
JMSF044N12Sequence800005372 (9)gb:AY227203_1591057e-106Lotus corniculatus aldehyde dehydrogenase 1 precursor (Aldh1) mRNA, complete cds772012597 (9)gb:AY227203_1591057e-107Lotus corniculatus aldehyde dehydrogenase 1 precursor (Aldh1) mRNA, complete cds
JMSF051J20Sequence678005372 (9)gb:AF269064_17820566e-82Zea mays T-cytoplasm male sterility restorer factor 2 (rf2) mRNA, rf2-R213 allel800012597 (9)gb:AY227203_1591057e-110Lotus corniculatus aldehyde dehydrogenase 1 precursor (Aldh1) mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044N12+ GGGAGGAAGACCAGCCTCATGGAATAGTTTCCCAGCATAAAGTGCGGTTAATGGTG
                      ____________________________________________________________
consensus GGGAGGAAGACCAGCCTCATGGAATAGTTTCCCAGCATAAAGTGCGGTTAATGGTG
 
. : . : . : . : . : . :
JMSF044N12+ TTTGCTCTGCAGTCTTTAGGACAACGGTATTCCCACAAGCTAACGCAGGCCCGACTTTCC
JMSF028F10+ AGCTAACGCAGGCCCGACTTTCC
JMSF028A14+ AGCTAACGCAGGCCCGACTTTCC
JMSF038P14+ CC
JMSF042L13+ TGCAGTCTTTAGGACAACGGTATTCCCACAAGCTAACGCAGGCCCGACTTTCC
                      ____________________________________________________________
consensus TTTGCTCTGCAGTCTTTAGGACAACGGTATTCCCACAAGCTAACGCAGGCCCGACTTTCC
 
. : . : . : . : . : . :
JMSF044N12+ AAGCAAACATGGCAAGAGGGAAGTTCCATGGGATAATTTGGCCAGCAACTCCTATTGGTT
JMSF028F10+ AAGCAAACATGGCAAGAGGGAAGTTCCATGGGATAATTTGGCCAGCAACTCCTATTGGTT
JMSF028A14+ AAGCAAACATGGCAAGAGGGAAGTTCCATGGGATAATTTGGCCAGCAACTCCTATTGGTT
JMSF038P14+ AAGCAAACATGGCAAGAGGGAAGTTCCATGGGATAATTTGGCCAGCAACTCCTATTGGTT
JMSF042L13+ AAGCAAACATGGCAAGAGGGAAGTTCCATGGGATAATTTGGCCAGCAACTCCTATTGGTT
JMSF051J20+ GGAAGTTCCATGGGATAATTTGGCCAGCAACTCCTATTGGTT
                      ____________________________________________________________
consensus AAGCAAACATGGCAAGAGGGAAGTTCCATGGGATAATTTGGCCAGCAACTCCTATTGGTT
 
. : . : . : . : . : . :
JMSF044N12+ CATGCAAGGTTTGGACATGGTGTGGTCCGTCAGCTGGAACTGTTAAACCATGGATTTTAT
JMSF028F10+ CATGCAAGGTTTGGACATGGTGTGGTCCGTCAGCTGGAACTGTTAAACCATGGATTTTAT
JMSF028A14+ CATGCAAGGTTTGGACATGGTGTGGTCCGTCAGCTGGAACTGTTAAACCATGGATTTTAT
JMSF038P14+ CATGCAAGGTTTGGACATGGTGTGGTCCGTCAGCTGGAACTGTTAAACCATGGATTTTAT
JMSF042L13+ CATGCAAGGTTTGGACATGGTGTGGTCCGTCAGCTGGAACTGTTAAACCATGGATTTTAT
JMSF051J20+ CATGCAAGGTTTGGACATGGTGTGGTCCGTCAGCTGGAACTGTTAAACCATGGATTTTAT
                      ____________________________________________________________
consensus CATGCAAGGTTTGGACATGGTGTGGTCCGTCAGCTGGAACTGTTAAACCATGGATTTTAT
 
. : . : . : . : . : . :
JMSF044N12+ CCGCCCATCCTGCATAGTAGTGAAATAGGCGTACAATCATGGGCAACTCTGATTTAGCAG
JMSF028F10+ CCGCCCATCCTGCATAGTAGTGAAATAGGCGTACAATCATGGGCAACTCTGATTTAGCAG
JMSF028A14+ CCGCCCATCCTGCATAGTAGTGAAATAGGCGTACAATCATGGGCAACTCTGATTTAGCAG
JMSF038P14+ CCGCCCATCCTGCATAGTAGTGAAATAGGCGTACAATCATGGGCAACTCTGATTTAGCAG
JMSF042L13+ CCGCCCATCCTGCATAGTAGTGAAATAGGCGTACAATCATGGGCAACTCTGATTTAGCAG
JMSF051J20+ CCGCCCATCCTGCATAGTAGTGAAATAGGCGTACAATCATGGGCAACTCTGATTTAGCAG
                      ____________________________________________________________
consensus CCGCCCATCCTGCATAGTAGTGAAATAGGCGTACAATCATGGGCAACTCTGATTTAGCAG
 
. : . : . : . : . : . :
JMSF044N12+ CCTGCTCGTATGGCTTCCCATTGTCCCACGTCTCCAATGTTGCAAGTTCATCCATGTGTT
JMSF028F10+ CCTGCTCGTATGGCTTCCCATTGTCCCACGTCTCCAATGTTGCAAGTTCATCCATGTGTT
JMSF028A14+ CCTGCTCGTATGGCTTCCCATTGTCCCACGTCTCCAATGTTGCAAGTTCATCCATGTGTT
JMSF038P14+ CCTGCTCGTATGGCTTCCCATTGTCCCATGTCTCCAATGTTGCAAGTTCATCCATGTGTT
JMSF042L13+ CCTGCTCGTATGGCTTCCCATTGTCCCACGTCTCCAATGTTGCAAGTTCATCCATGTGTT
JMSF051J20+ CCTGCTCGTATGGCTTCCCATTGTCCCACGTCTCCAATGTTGCAAGTTCATCCATGTGTT
                      ____________________________________________________________
consensus CCTGCTCGTATGGCTTCCCATTGTCCCACGTCTCCAATGTTGCAAGTTCATCCATGTGTT
 
. : . : . : . : . : . :
JMSF044N12+ TCTCGACCAAATCAGCAAACTTCAACATTATCCGCGATCTCTCATATGCACTCATTTTGG
JMSF028F10+ TCTCGACCAAATCAGCAAACTTCAACATTATCCGCGATCTCTCATATGCACTCATTTTGG
JMSF028A14+ TCTCGACCAAATCAGCAAACTTCAACATTATCCGCGATCTCTCATATGCACTCATTTTGG
JMSF038P14+ TCTCGACCAAATCAGCAAACTTCAACATTATCCGCGATCTCTCATATGCACTCATTTTGG
JMSF042L13+ TCTCGACCAAATCAGCAAACTTCAACATTATCCGCGATCTCTCATATGCACTCATTTTGG
JMSF051J20+ TCTCGACCAAATCAGCAAACTTCAACATTATCCGCGATCTCTCATATGCACTCATTTTGG
                      ____________________________________________________________
consensus TCTCGACCAAATCAGCAAACTTCAACATTATCCGCGATCTCTCATATGCACTCATTTTGG
 
. : . : . : . : . : . :
JMSF044N12+ GCCAAGGTCCCTCATCGAAAGCCTTGCGGGCAGCTGCTACAGCGCGGTTTATATCTTCCG
JMSF028F10+ GCCAAGGTCCCTCATCGAAAGCCTTGCGGGCAGCTGCTACAGCGCGGTTTATATCTTCCG
JMSF002F23+ CCTCATCGAAAGCCTTGCGGGCAGCTGCTACAGCGCGGTTTATATCTTCCG
JMSF028A14+ GCCAAGGTCCCTCATCGAAAGCCTTGCGGGCAGCTGCTACAGCGCGGTTTATATCTTCCG
JMSF038P14+ GCCAAGGTCCCTCATCGAAAGCCTTGCGGGCAGCTGCTACAGCGCGGTTTATATCTTCCG
JMSF042L13+ GCCAAGGTCCCTCATCGAAAGCCTTGCGGGCAGCTGCTACAGCGCGGTTTATATCTTCCG
JMSF018P02+ ATCGAAAGCCTTGCGGGCAGCTGCTACAGCGCGGTTTATATCTTCCG
JMSF051J20+ GCCAAGGTCCCTCATCGAAAGCCTTGCGGGCAGCTGCTACAGCGCGGTTTATATCTTCCG
                      ____________________________________________________________
consensus GCCAAGGTCCCTCATCGAAAGCCTTGCGGGCAGCTGCTACAGCGCGGTTTATATCTTCCG
 
. : . : . : . : . : . :
JMSF044N12+ CTTCACCCTCTGCTACATGTGCAATGACATCTTCAGTTCTCGGATCCAAGGTTGGGAATG
JMSF028F10+ CTTCACCCTCTGCTACATGTGCAATGACATCTTCAGTTCTCGGATCCAAGGTTGGGAATG
JMSF002F23+ CTTCACCCTCTGCTACATGTGCAATGACATCTTCAGTTCTCGGATCCAAGGTTGGGAATG
JMSF028A14+ CTTCACCCTCTGCTACATGTGCAATGACATCTTCAGTTCTCGGATCCAAGGTTGGGAATG
JMSF038P14+ CTTCACCCTCTGCTACATGTGCAATGACATCTTCAGTTCTCGGATCCAAGGTTGGGAATG
JMSF042L13+ CTTCACCCTCTGCTACATGTGCAATGACATCTTCAGTTCTCGGATCCAAGGTTGGGAATG
JMSF018P02+ CTTCACCCTCTGCTACATGTGCAATGACATCTTCAGTTCTCGGATCCAAGGTTGGGAATG
JMSF051J20+ CTTCACCCTCTGCTACATGTGCAATGACATCTTCAGTTCTCGGATCCAAGGTTGGGAATG
                      ____________________________________________________________
consensus CTTCACCCTCTGCTACATGTGCAATGACATCTTCAGTTCTCGGATCCAAGGTTGGGAATG
 
. : . : . : . : . : . :
JMSF044N12+ TTTTTCCAGAAGCTGAATCTACAAATTTGCCATTGATTATATGTTGGGTGTATTTAACTT
JMSF028F10+ TTTTTCCAGAAGCTGAATCTACAAATTTGCCATTGATTATATGTTGGGTGTATTTAACTT
JMSF002F23+ TTTTTCCAGAAGCTGAATCTACAAATTTGCCATTGATTATATGTTGGGTGTATTTAACTT
JMSF028A14+ TTTTTCCAGAAGCTGAATCTACAAATTTGCCATTGATTATATGTTGGGTGTATTTAACTT
JMSF038P14+ TTTTTCCAGAAGCTGAATCTACAAATTTGCCATTGATTATATGTTGGGTGTATTTAACTT
JMSF042L13+ TTTTTCCAGAAGCTGAATCTACAAATTTGCCATTGATTATATGTTGGGTGTATTTAACTT
JMSF018P02+ TTTTTCCAGAAGCTGAATCTACAAATTTGCCATTGATTATATGTTGGGTGTATTTAACTT
JMSF051J20+ TTTTTCCAGAAGCTGAATCTACAAATTTGCCATTGATTATATGTTGGGTGTATTTAACTT
                      ____________________________________________________________
consensus TTTTTCCAGAAGCTGAATCTACAAATTTGCCATTGATTATATGTTGGGTGTATTTAACTT
 
. : . : . : . : . : . :
JMSF044N12+ CCACAGCCGGAGAAACTAACTCCTCAACTGCGGCTGCAGTGCTGAACCTTTGTATGCCAC
JMSF028F10+ CCACAGCCGGAGAAACTAACTCCTCAACTGCGGCTGCAGTGCTGAACCTTTGTATGCCAC
JMSF002F23+ CCACAGCCGGAGAAACTAACTCCTCAACTGCGGCTGCAGTGCTGAACCTTTGTATGCCAC
JMSF028A14+ CCACAGCCGGAGAAACTAACTCCTCAACTGCGGCTGCAGTGCTGAACCTTTGTATGCCAC
JMSF038P14+ CCACAGCCGGAGAAACTAACTCCTCAACTGCGGCTGCAGTGCTGAACCTTTGTATGCCAC
JMSF042L13+ CCACAGCCGGAGAAACTAACTCCTCAACTGCGGCTGCAGTGCTGAACCTTTGTATGCCAC
JMSF018P02+ CCACAGCCGGAGAAACTAACTCCTCAACTGCGGCTGCAGTGCTGAACCTTTGTATGCCAC
JMSF051J20+ CCACAGCCGGAGAAACTAACTCCTCAACTGCGGCTGCAGTGCTGAACCTTTGTATGCCAC
JMSF013B20+ CTGCAGTGCTGAACCTTTGTATGCCAC
                      ____________________________________________________________
consensus CCACAGCCGGAGAAACTAACTCCTCAACTGCGGCTGCAGTGCTGAACCTTTGTATGCCAC
 
. : . : . : . : . : . :
JMSF044N12+ TTTCTACACCATACTTCCACCCCAGAAAAGCAGATGCAGAAGGAAAAGAGAGTGAACGAG
JMSF028F10+ TTTCTACACCATACTTCCACCCCAGAAAAGCAGATGCAGAAGGAAAAGAGAGTGAACGAG
JMSF002F23+ TTTCTACACCATACTTCCACCCCAGAAAAGCAGATGCAGAAGGAAAAGAGAGTGAACGAG
JMSF028A14+ TTTCTACACCATACTTCCACCCCAGAAAAGCAGATGCAGAAGGAAAAGAGAGTGAACGAG
JMSF038P14+ TTTCTACACCATACTTCCACCCCAGAAAAGCAGATGCAGAAGGAAAAGAGAGTGAACGAG
JMSF042L13+ TTTCTACACCATACTTCCACCCCAGAAAAGCAGATGCAGAAGGAAAAGAGAGTGAACGAG
JMSF018P02+ TTTCTACACCATACTTCCACCCCAGAAAAGCAGATGCAGAAGGAAAAGAGAGTGAACGAG
JMSF051J20+ TTTCTACACCATACTTCCACCCCAGAAAAGCAGATGCAGAAGGAAAAGAGAGTGAACGAG
JMSF013B20+ TTTCTACACCATACTTCCACCCCAGAAAAGCAGATGCAGAAGGAAAAGAGAGTGAACGAG
                      ____________________________________________________________
consensus TTTCTACACCATACTTCCACCCCAGAAAAGCAGATGCAGAAGGAAAAGAGAGTGAACGAG
 
. : . : . : . : . : . :
JMSF044N12+ AAAGCAAGGTAGAAAGTCTGCGAGAAGCCATTTTTGTGCTCTCAACCTTAGCTTCTTCAC
JMSF028F10+ AAAGCAAGGTAGAAAGTCTGCGAGAAGCCATTTTTGTGCTCTCAACCTTAGCTTCTTC
JMSF002F23+ AAAGCAAGGTAGAAAGTCTGCGAGAAGCCATTTTTGTGCTCTCAACCT
JMSF028A14+ AAAGCAAGGTAGAAAGTCTGCGAGAAGCCATTTTTGTGCTCTCAACCTTAGCTTCTTC
JMSF038P14+ AAAGCAAGGTAGAAAGTCTGCGAGAAGCCATTTTTGTGCTCTCAACCTTAGCTTCTTCAC
JMSF042L13+ AAAGCAAGGTAGAAAGTCTGCGAGAAGCCATTTTTGTGCTCTCAACCTTAGCTTCTTCAC
JMSF018P02+ AAAGCAAGGTAGAAAGTCTGCGAGAAGCCATTTTTGTGCTCTCAACCTTAGCTTCTTCAC
JMSF051J20+ AAAGCAAGGTAGAAAGTCTGCGAGAAGCCATTTTTGTGCTCTCAACCTTAGCTTCTTCAC
JMSF013B20+ AAAGCAAGGTAGAAAGTCTGCGAGAAGCCATTTTTGTGCTCTCAACCTTAGCTTCTTCAC
                      ____________________________________________________________
consensus AAAGCAAGGTAGAAAGTCTGCGAGAAGCCATTTTTGTGCTCTCAACCTTAGCTTCTTCAC
 
. : . : . : . : . : . :
JMSF044N12+ TTTTCAGATTTCTTTAATTTTTC
JMSF038P14+ TTTTCAGATTTCTTT
JMSF042L13+ TTTTCAGATTTCTTTAATTTTTCTTT
JMSF018P02+ TTTTCAGATTTCTTTAATTTTTCTTT
JMSF051J20+ TTTTCAGATTTCTTTAATTTTTCTTTGGGTTTTGT
JMSF013B20+ TTTTCAGATTTCTTTAATTTTTCTTTGGGTTTTGTGAATTGCCTGATTCTTATCTATACT
                      ____________________________________________________________
consensus TTTTCAGATTTCTTTAATTTTTCTTTGGGTTTTGTGAATTGCCTGATTCTTATCTATACT
 
. : . : . : . : . : . :
JMSF013B20+ CTCCAACAAAATATGGCAACACTGATGGCAAGTAACAAGTTGACAACAGAGTGACAACTC
                      ____________________________________________________________
consensus CTCCAACAAAATATGGCAACACTGATGGCAAGTAACAAGTTGACAACAGAGTGACAACTC