Previous Contig 005370:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF013B11Sequence501005370 (2)pir|T51888|T518887e-26asparagine synthase (glutamine-hydrolyzing) (EC 6.3.5.4) [validated] - Arabidops727011724 (2)gb:AF530460_18090772e-82Striga hermonthica asparagine synthetase (AS) mRNA, complete cds.
JMSF023A19Sequence391005370 (2)pir|T51888|T518889e-39asparagine synthase (glutamine-hydrolyzing) (EC 6.3.5.4) [validated] - Arabidops723011724 (2)gb:AF530460_18090773e-81Striga hermonthica asparagine synthetase (AS) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF013B11+ TGAAGCAANCCACACAGACCC
                      ____________________________________________________________
consensus TGAAGCAANCCACACAGACCC
 
. : . : . : . : . : . :
JMSF013B11+ ATCAAGTCCCCAGCCCATATAAAGTGGCGTAATACCAATAGCATCCCTGGCAGCAATGAA
                      ____________________________________________________________
consensus ATCAAGTCCCCAGCCCATATAAAGTGGCGTAATACCAATAGCATCCCTGGCAGCAATGAA
 
. : . : . : . : . : . :
JMSF023A19+ CATTGACCGTGACAACAATGGTTTTGTCTTCATTGTACAGTGGTTGATCTCCAGAAGTA
JMSF013B11+ ACATTGACCGTGACAACAATGGTTTTGTCTTCATTGTACAGTGGTTGATCTCCAGAAGTA
                      ____________________________________________________________
consensus ACATTGACCGTGACAACAATGGTTTTGTCTTCATTGTACAGTGGTTGATCTCCAGAAGTA
 
. : . : . : . : . : . :
JMSF023A19+ GGATCAATAANTGGTAATCGTTGATGTGCAAGATAACAATCACCCTGGCAATGCAATCCA
JMSF013B11+ GGATCAATAATTGCTAATCGTTGATGTGCAAGATAACAATCACCCTGGCAATGCAATCCA
                      ____________________________________________________________
consensus GGATCAATAATTGGTAATCGTTGATGTGCAAGATAACAATCACCCTGGCAATGCAATCCA
 
. : . : . : . : . : . :
JMSF023A19+ CTCCAATCGGGTCCTCTATGGCGCAACCTCCTAGAAAGCTCGATGATTCTGGACCGCTTC
JMSF013B11+ CTCCAATCGGGTCCTCTATGGCGCAACCTCCTAGAAAGCTCGATGATTCTGGACCGCTTC
                      ____________________________________________________________
consensus CTCCAATCGGGTCCTCTATGGCGCAACCTCCTAGAAAGCTCGATGATTCTGGACCGCTTC
 
. : . : . : . : . : . :
JMSF023A19+ GCCTGAGAGTTGTCTGTGCAACCGAACACTGCAAGTATTCCACACATGGCGGCGCCTCTC
JMSF013B11+ GCCTGAGAGTTGTCTGTGCAACCGAAAACTGCAAGTATTCCACACATGGCGGCGCCTCTC
                      ____________________________________________________________
consensus GCCTGAGAGTTGTCTGTGCAACCGAACACTGCAAGTATTCCACACATGGCGGCGCCTCTC
 
. : . : . : . : . : . :
JMSF023A19+ TCTCTCTCTCTCTCTCCCTCTCTCTCTCAAGTTATCTGTACGTGCGTATCTATACGCTGT
JMSF013B11+ TCTCTCTCTCTCTCTCCCTCTCTCTCTCAAGTTATCTGTACGTGCGTATCTATATGCTGT
                      ____________________________________________________________
consensus TCTCTCTCTCTCTCTCCCTCTCTCTCTCAAGTTATCTGTACGTGCGTATCTATATGCTGT
 
. : . : . : . : . : . :
JMSF023A19+ CTGAATAG
JMSF013B11+ CTGAATAGGACCTATGGGAGAGAAGAGATAGGTTGGAATGAAATGGAAGTGGAGGCTGGA
                      ____________________________________________________________
consensus CTGAATAGGACCTATGGGAGAGAAGAGATAGGTTGGAATGAAATGGAAGTGGAGGCTGGA
 
. : . : . : . : . : . :
JMSF013B11+ GGCTGCTGAGAGCTGAGCCGCCCGCTATGAGCCTTTACAAACTGGTGGCTTGACCCCCCC
                      ____________________________________________________________
consensus GGCTGCTGAGAGCTGAGCCGCCCGCTATGAGCCTTTACAAACTGGTGGCTTGACCCCCCC