Previous Contig 005363:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001I10Sequence484005363 (2)gb:AE016959_10235076e-29Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC07726011150 (2)gb:AC016661_15381837e-15Arabidopsis thaliana chromosome 3 BAC F11F8 genomic sequence, complete sequence.
JMSF013A22Sequence483005363 (2)gb:AE016959_10221302e-34Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09784011150 (2)gb:AC016661_15381838e-18Arabidopsis thaliana chromosome 3 BAC F11F8 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF001I10+ CCAGCGCGTGTTCTTGCGAATGATTT
                      ____________________________________________________________
consensus CCAGCGCGTGTTCTTGCGAATGATTT
 
. : . : . : . : . : . :
JMSF001I10+ CCCGGGTTTCAGACAGGCTGCTCCAAATAATAAAGGATGGGTTGTGACCTTTAACAGAAT
                      ____________________________________________________________
consensus CCCGGGTTTCAGACAGGCTGCTCCAAATAATAAAGGATGGGTTGTGACCTTTAACAGAAT
 
. : . : . : . : . : . :
JMSF001I10+ CAAAAAAAGAGGAGTTAGGATAATATCTGCATTTGAACAATCTGGCAGCAAGAGAGAGGA
                      ____________________________________________________________
consensus CAAAAAAAGAGGAGTTAGGATAATATCTGCATTTGAACAATCTGGCAGCAAGAGAGAGGA
 
. : . : . : . : . : . :
JMSF001I10+ TTTTCTATTAATCTCCAAGATTGCTTGCAGAGGAGAGCTAAGTTAAACTCCCTGAGACTT
                      ____________________________________________________________
consensus TTTTCTATTAATCTCCAAGATTGCTTGCAGAGGAGAGCTAAGTTAAACTCCCTGAGACTT
 
. : . : . : . : . : . :
JMSF001I10+ CTGAAACCAAGACCTCCCCAAAGCTTAGGGACACATAAAGATGACTAAGATTTCCAACGG
                      ____________________________________________________________
consensus CTGAAACCAAGACCTCCCCAAAGCTTAGGGACACATAAAGATGACTAAGATTTCCAACGG
 
. : . : . : . : . : . :
JMSF001I10+ ATTCCTTGCCTCCCACCTACTTCACCCTTCCACCAAAAGGCATTCATGACTCTTTCAATC
JMSF013A22+ ATC
                      ____________________________________________________________
consensus ATTCCTTGCCTCCCACCTACTTCACCCTTCCACCAAAAGGCATTCATGACTCTTTCAATC
 
. : . : . : . : . : . :
JMSF001I10+ TCACTGGTAAGGCTCTTTGGAAGAAGGAAAACGCTCATGGCATAGCACGGGATGGCTTGT
JMSF013A22+ TCACTGGTAAGGCTCTTTGGAAGAAGGAAAACGCTCATGGCATAGCACGGGATGGCTTGT
                      ____________________________________________________________
consensus TCACTGGTAAGGCTCTTTGGAAGAAGGAAAACGCTCATGGCATAGCACGGGATGGCTTGT
 
. : . : . : . : . : . :
JMSF001I10+ ATGACATTTTTCAATAGAATCTCTCTTCCAGCTCTAGAAAGGAGCTTGTGACCCCAACTC
JMSF013A22+ ATGACATTTTTCAATAGAATCTCTCTTCCAGCTCTAGAAAGGAGCTTGTGACCCCAACTC
                      ____________________________________________________________
consensus ATGACATTTTTCAATAGAATCTCTCTTCCAGCTCTAGAAAGGAGCTTGTGACCCCAACTC
 
. : . : . : . : . : . :
JMSF001I10+ TGCACTCTTGAAACGATTCTGTTTTTGATAAAACC
JMSF013A22+ TGCACTCTTGAAACGATTCTGTTTTTGATAAAACCCAAGATTTGAGTCTTGTTTCTGCCC
                      ____________________________________________________________
consensus TGCACTCTTGAAACGATTCTGTTTTTGATAAAACCCAAGATTTGAGTCTTGTTTCTGCCC
 
. : . : . : . : . : . :
JMSF013A22+ ACAAGAGAGGGGAGACCAAGATAAAATCCATTGCAAATGTCCCTCCTAACACCAAGTATG
                      ____________________________________________________________
consensus ACAAGAGAGGGGAGACCAAGATAAAATCCATTGCAAATGTCCCTCCTAACACCAAGTATG
 
. : . : . : . : . : . :
JMSF013A22+ TCTTCCACTTGAATGCAGACTGATTCCCCTACATTTTTGCTGAAAATAAGGGCTGATTTG
                      ____________________________________________________________
consensus TCTTCCACTTGAATGCAGACTGATTCCCCTACATTTTTGCTGAAAATAAGGGCTGATTTG
 
. : . : . : . : . : . :
JMSF013A22+ TCAAGGTTGATGACTTGACCTGAGGCAGCCGAATAAGAATCCAGAATTGATTTAAAGACC
                      ____________________________________________________________
consensus TCAAGGTTGATGACTTGACCTGAGGCAGCCGAATAAGAATCCAGAATTGATTTAAAGACC
 
. : . : . : . : . : . :
JMSF013A22+ ATAGTTTCAGTAGGATCAGCTCTGAAAAAGAAATAACTATCATCCGCGAAAAGTAGATGT
                      ____________________________________________________________
consensus ATAGTTTCAGTAGGATCAGCTCTGAAAAAGAAATAACTATCATCCGCGAAAAGTAGATGT
 
. : . : . : . : . : . :
JMSF013A22+ GTGATGATTGGAGCATTTCTGGCAATTGAGACACCATGAAGGGAACCTTGCCGTTCAGTC
                      ____________________________________________________________
consensus GTGATGATTGGAGCATTTCTGGCAATTGAGACACCATGAAGGGAACCTTGCCGTTCAGTC