Previous Contig 005362:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS026F11Sequence626005362 (8)gb:AP005558_18540285e-53Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ11
JMFS026F12Sequence629005362 (8)gb:AP005558_18540285e-53Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ11
JMFS041F04Sequence621005362 (8)gb:AC006919_15347183e-05Arabidopsis thaliana chromosome 2 clone F1O11 map g6825, complete sequence.>gb:A
JMSF012J18Sequence388005362 (8)801005362 (8)gb:AC006919_15347184e-13Arabidopsis thaliana chromosome 2 clone F1O11 map g6825, complete sequence.>gb:A
JMSF013A16Sequence367005362 (8)786005362 (8)gb:AC006919_15347184e-14Arabidopsis thaliana chromosome 2 clone F1O11 map g6825, complete sequence.>gb:A
JMSF045K03Sequence778005362 (8)pir|C84781|C847814e-20hypothetical protein At2g36480 [imported] - Arabidopsis thaliana708024167gb:AC006919_15347171e-21Arabidopsis thaliana chromosome 2 clone F1O11 map g6825, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS026F12+ TTCATTCAATTGACCTTTCTGAACACGGTGAATATTCTTG
JMFS026F11+ ATTCAATTGACCTTTCTGAACACGGTGAATATTCTTG
                      ____________________________________________________________
consensus TTCATTCAATTGACCTTTCTGAACACGGTGAATATTCTTG
 
. : . : . : . : . : . :
JMFS026F12+ ATAGAAGGATCCACCCATGATCTTCCCGGAGGACCAGAACTAACACTAGCTGTTCTCTCC
JMFS026F11+ ATAGAAGGATCCACCCATGATCTTCCCGGAGGACCAGAACTAACACTAGCTGTTCTCTCC
                      ____________________________________________________________
consensus ATAGAAGGATCCACCCATGATCTTCCCGGAGGACCAGAACTAACACTAGCTGTTCTCTCC
 
. : . : . : . : . : . :
JMFS026F12+ AGTCTCTCTACATCCTCAGATGAGCTTACAAGTGTTGCACTAATGCCACCAGCATTTCCC
JMFS026F11+ AGTCTCTCTACATCCTCAGATGAGCTTACAAGTGTTGCACTAATGCCACCAGCATTTCCC
                      ____________________________________________________________
consensus AGTCTCTCTACATCCTCAGATGAGCTTACAAGTGTTGCACTAATGCCACCAGCATTTCCC
 
. : . : . : . : . : . :
JMFS026F12+ TTTGCCCTAGCTGGCTGCTGCAGGCTCTGCCTAGCCTCCAAATACTTGGGATTGACATGA
JMFS026F11+ TTTGCCCTAGCTGGCTGCTGCAGGCTCTGCCTAGCCTCCAAATACTTGGGATTGACATGA
                      ____________________________________________________________
consensus TTTGCCCTAGCTGGCTGCTGCAGGCTCTGCCTAGCCTCCAAATACTTGGGATTGACATGA
 
. : . : . : . : . : . :
JMFS026F12+ ATACTACGTGCAGGACGTGGAGTCTGTGATTCATTTCTAGAAGTTGTTCCTGAAGATGAA
JMFS026F11+ ATACTACGTGCAGGACGTGGAGTCTGTGATTCATTTCTAGAAGTTGTTCCTGAAGATGAA
                      ____________________________________________________________
consensus ATACTACGTGCAGGACGTGGAGTCTGTGATTCATTTCTAGAAGTTGTTCCTGAAGATGAA
 
. : . : . : . : . : . :
JMFS026F12+ CCATTGACCCCAGTTGTAAATCCAAGCTCCTTCTCAATTAATTGAAGTGTTTGTGGAGGG
JMFS026F11+ CCATTGACCCCAGTTGTAAATCCAAGCTCCTTCTCAATTAATTGAAGTGTTTGTGGAGGG
                      ____________________________________________________________
consensus CCATTGACCCCAGTTGTAAATCCAAGCTCCTTCTCAATTAATTGAAGTGTTTGTGGAGGG
 
. : . : . : . : . : . :
JMFS026F12+ AACACCCCTTTCCATGTTCCAAAAAGATGCCGCATGCCAGAATGTATTGATGGATCAACC
JMFS026F11+ AACACCCCTTTCCATGTTCCAAAAAGATGCCGCATGCCAGAATGTATTGATGGATCAACC
                      ____________________________________________________________
consensus AACACCCCTTTCCATGTTCCAAAAAGATGCCGCATGCCAGAATGTATTGATGGATCAACC
 
. : . : . : . : . : . :
JMFS026F12+ TGTCTGTACACCTTGCAAAAAACCTCTGGTAGCCTGGTAGCAAAATACTTAATATAATCC
JMFS026F11+ TGTCTGTACACCTTGCAAAAAACCTCTGGTAGCCTGGTAGCAAAATACTTAATATAATCC
                      ____________________________________________________________
consensus TGTCTGTACACCTTGCAAAAAACCTCTGGTAGCCTGGTAGCAAAATACTTAATATAATCC
 
. : . : . : . : . : . :
JMFS026F12+ CTCCCAATATTCTTCACAATACTGTCCAAAAGATAGAGAGATGGCAACTTTTGATCACTG
JMFS026F11+ CTCCCAATATTCTTCACAATACTGTCCAAAAGATAGAGAGATGGCAACTTTTGATCACTG
                      ____________________________________________________________
consensus CTCCCAATATTCTTCACAATACTGTCCAAAAGATAGAGAGATGGCAACTTTTGATCACTG
 
. : . : . : . : . : . :
JMFS026F12+ GGAACCTCAATAATGTTGGCACAGATCGTGGCTGCAATAGCCTTGGCAGCTGGTATACTC
JMFS026F11+ GGAACCTCAATAATGTTGGCACAGATCGTGGCTGCAATAGCCTTGGCAGCTGGTATACTC
rJMSF013A16- ACCTCAATAATGTTGGCACAGATCGTGGCTGCAATAGCCTTGGCAGCTGGTATACTC
rJMSF012J18- ACCTCAATAATGTTGGCACAGATCGTGGCTGCAATAGCCTTGGCAGCTGGTATACTC
JMSF045K03+ ACCTCAATAATGTTGGCACAGATCGTGGCTGCAATAGCCTTGGCAGCTGGTATACTC
                      ____________________________________________________________
consensus GGAACCTCAATAATGTTGGCACAGATCGTGGCTGCAATAGCCTTGGCAGCTGGTATACTC
 
. : . : . : . : . : . :
JMFS026F12+ TCGCCGGCAATGATAGTCAAGTTGGTGATTATTGGCTTCGAATTGAAGG
JMFS026F11+ TCGCCGGCAATGATAGTCAAGTTGGTGATTATTGGCTTCGAATTGAAGG
rJMSF013A16- TCGCCGGCAATGATAGTCAAGTTGGTGATTATTGGCTTCGAATTGAAGGTCAGCTCAGCC
rJMSF012J18- TAGCCGGCAATGATAGTCAAGTTGGTGATTATTGGCTTCGAATTGAAGGTCAGCTCAGCC
JMFS041F04+ CAGCC
JMSF045K03+ TCGCCGGCAATGATAGTCAAGTTGGTGATTATTGGCTTCGAATTGAAGGTCAGCTCAGCC
                      ____________________________________________________________
consensus TCGCCGGCAATGATAGTCAAGTTGGTGATTATTGGCTTCGAATTGAAGGTCAGCTCAGCC
 
. : . : . : . : . : . :
rJMSF013A16- AAAGCCGTCTTATACTGACTGACCAGCTCCTGATGATTCTGTTGCTGCTGTTGTTGTGGA
rJMSF012J18- AAAGCCGTCTTATACTGACTGACCAGCTCCTGATGATTCTGTTGCTGCTGTTGTTGTGGA
JMFS041F04+ AAAGCCGTCTTATACTGACTGACCAGCTCCTGATGATTCTGTGNCTGCTGTTGTTGTGGA
JMSF045K03+ AAAGCCGTCTTATACTGACTGACCAGCTCCTGATGATTCTGTTGCTGCTGTTGTTGTGGA
                      ____________________________________________________________
consensus AAAGCCGTCTTATACTGACTGACCAGCTCCTGATGATTCTGTTGCTGCTGTTGTTGTGGA
 
. : . : . : . : . : . :
rJMSF013A16- TAAGATCCACGAACTGAGTCACTACTCTCTGAGTCTCCTCCTCCCCTCTCGCTAGCTCGA
rJMSF012J18- TAAGATCCACGAACTGAGTCACTACTCTCTGAGTCTCCTCCTCCCCTCTCGCTAGCTCGA
JMFS041F04+ TAAGATCCACGAACTGAGTCACTACTCTNTGAGTCTCCTCCTCCCCTCTCGCTAGCTCGA
JMSF045K03+ TAAGATCCACGAACTGAGTCACTACTCTCTGAGTCTCCTCCTCCCCTCTCGCTAGCTCGA
                      ____________________________________________________________
consensus TAAGATCCACGAACTGAGTCACTACTCTCTGAGTCTCCTCCTCCCCTCTCGCTAGCTCGA
 
. : . : . : . : . : . :
rJMSF013A16- AATCTTGAGCCTACTGAGCCTGAAGCCATCGGCCGTTGCTGAACAACACTCCGTACATTC
rJMSF012J18- AATCTTGAGCCTACTGAGCCTGAAGCCATCGGCCGTTGCTGAACAACACTCCGTACATTC
JMFS041F04+ AATCTTGAGCCTACTGAGCCTGAAGCCATCGGCCGTTGCTGAACAACACTCCGTACATTC
JMSF045K03+ AATCTTGAGCCTACTGAGCCTGAAGCCATCGGCCGTTGCTGAACAACACTCCGTACATTC
                      ____________________________________________________________
consensus AATCTTGAGCCTACTGAGCCTGAAGCCATCGGCCGTTGCTGAACAACACTCCGTACATTC
 
. : . : . : . : . : . :
rJMSF013A16- AGCGTACGATTCATAGCAGGATCTTCAGCTAATCTCGGTTTCTTCAGCCCCGGCTCGATT
rJMSF012J18- AGCGTACGATTCATAGCAGGATCTTCAGCTAATCTCGGTTTCTTCAGCCCCGGCTCGATT
JMFS041F04+ AGCGTACGATTCATAGCAGGATCTTCAGCTAATCTCGGTTTCTTCAGCCCCGGCTCGATT
JMSF045K03+ AGCGTACGATTCATAGCAGGATCTTCAGCTAATCTCGGTTTCTTCAGCCCCGGCTCGATT
JMSF012J18+ TT
                      ____________________________________________________________
consensus AGCGTACGATTCATAGCAGGATCTTCAGCTAATCTCGGTTTCTTCAGCCCCGGCTCGATT
 
. : . : . : . : . : . :
rJMSF013A16- CTCGATCTGTCAAATGGTCTACGAGAATTCTCCATCTCCATCAATTATTCTCACCACTCA
rJMSF012J18- CTCGATCTGTCAAATGGTCTACGAGAATTCTCCATCTCCATCAATTATTCTCACCACTCA
JMFS041F04+ CTCGATCTGTCAAATGGTCTACGAGAATTCTCCATCTCCATCAATTATTCTCACCACTCA
JMSF045K03+ CTCGATCTGTCAAATGGTCTACGAGAATTCTCCATCTCCATCAATTATTCTCACCACTCA
JMSF012J18+ CTCGATCTGTCAAATGGTCTACGAGAATTCTCCATCTCCATCAATTATTCTCACCACTCA
JMSF013A16+ CCACTCA
                      ____________________________________________________________
consensus CTCGATCTGTCAAATGGTCTACGAGAATTCTCCATCTCCATCAATTATTCTCACCACTCA
 
. : . : . : . : . : . :
rJMSF013A16- AACAAACCCTAATCCGCTCTATGGTACATCAATTACAGGGTTACAAAAAAAACCACAATA
rJMSF012J18- AACAAACCCTAATCCGCTCTATGGTACATCAATTACAGGGTTACAAAAAAAACCACAATA
JMFS041F04+ AACAAACCCTAATCCGCTCTATGGTACATCAATTACAGGGTTACAAAAAAAACCACAATA
JMSF045K03+ AACAAACCCTAATCCGCTCTATGGTACATCAATTACAGGGTTACAAAAAAAACCACAATA
JMSF012J18+ AACAAACCCTAATCCGCTCTATGGTACATCAATTACAGGGTTACAAAAAAAACCACAATA
JMSF013A16+ AACAAACCCTAATCCGCTCTATGGTACATCAATTACAGGGTTACAAAAAAAACCACAATA
                      ____________________________________________________________
consensus AACAAACCCTAATCCGCTCTATGGTACATCAATTACAGGGTTACAAAAAAAACCACAATA
 
. : . : . : . : . : . :
rJMSF013A16- AATTAAATTAAATTAAATTAAATTAAATTAAAAAGTCTATAACTCATTCATCATTATTAT
rJMSF012J18- AATTAAATTAAATTAAATTAAATTAAATTAAAAAGTCTATAACTCATTCATCATTATTAT
JMFS041F04+ AATTAAATTAAATTAAATTAAATTAAATTAAAAAGTCTATAACTCATTCATCATTATTAT
JMSF045K03+ AATTAAATTAAATTAAATTAAATTAAATTAAAAAGTCTATAACTCATTCATCATTATTAT
JMSF012J18+ AATTAAATTAAATTAAATTAAATTAAATTAAAAAGTCTATAACTCATTCATCATTATTAT
JMSF013A16+ AATTAAATTAAATTAAATTAAATTAAATTAAAAAGTCTATAACTCATTCATCATTATTAT
                      ____________________________________________________________
consensus AATTAAATTAAATTAAATTAAATTAAATTAAAAAGTCTATAACTCATTCATCATTATTAT
 
. : . : . : . : . : . :
rJMSF013A16- GTAAATGAGAATTACAAGAATGAAAGACTATGAAACTAAATCCGATCTATGCATCTTCNC
rJMSF012J18- GTAAATGAGAATTACAAGAATGAAAGACTATGAAACTAAATCCGATCTATGCATCTTCAC
JMFS041F04+ GTAAATGAGAATTACAAGAATGAAAGACTATGAAACTAAATCCGATCTATGCATCTTCAC
JMSF045K03+ GTAAATGAGAATTACAAGAATGAAAGACTATGAAACTAAATCCGATCTATGCATCTTCAC
JMSF012J18+ GTAAATGAGAATTACAAGAATGAAAGACTATGAAACTAAATCCGATCTATGCATCTTCAC
JMSF013A16+ GTAAATGAGAATTACAAGAATGAAAGACTATGAAACTAAATCCGATCTATGCATCTTCAC
                      ____________________________________________________________
consensus GTAAATGAGAATTACAAGAATGAAAGACTATGAAACTAAATCCGATCTATGCATCTTCAC
 
. : . : . : . : . : . :
rJMSF013A16- ATAAAAACCTGAAGCTGGTAAACTGCATCT
rJMSF012J18- ATAGAAACCTGAAGCTGGTAAACTGCATCTCAA
JMFS041F04+ ATAGAAACCTGAAGCTGGTAAACTGCATCTCAAATCTCAAAGTATACAATGACAAATCTG
JMSF045K03+ ATAGAAACCTGAAGCTGGTAAACTGCATCTCAAATCTCAAAGTATACAATGACAAATCTG
JMSF012J18+ ATAGAAACCTGAAGCTGGTAAACTGCATCTCAAATCTCAAAGTATACAATGACAAATCTG
JMSF013A16+ ATAGAAACCTGAAGCTGGTAAACTGCATCTCAAATCTCAAAGTATACAATGACAAATCTG
                      ____________________________________________________________
consensus ATAGAAACCTGAAGCTGGTAAACTGCATCTCAAATCTCAAAGTATACAATGACAAATCTG
 
. : . : . : . : . : . :
JMFS041F04+ AGACCCGGTAGCCGAATTGATTATCGGTTATCGGTTGGGTATGGGTAGATTGATTCGGGT
JMSF045K03+ AGACCCGGTAGCCGAATTGATTATCGGTTATCGGTTGGGTATGGGTAGATTGATTCGGGT
JMSF012J18+ AGACCCGGTAGCCGAATTGATTATCGGTTATCGGTTGGGTATGGGTAGATTGATTCGGGT
JMSF013A16+ AGACCCGGTAGCCGAATTGATTATCGGTTATCGGTTGGGTATGGGTAGATTGATTCGGGT
                      ____________________________________________________________
consensus AGACCCGGTAGCCGAATTGATTATCGGTTATCGGTTGGGTATGGGTAGATTGATTCGGGT
 
. : . : . : . : . : . :
JMFS041F04+ GGAAATCTAGGGTTTC
JMSF045K03+ GGAAATCTAGGGTTTC
JMSF012J18+ GGAAATCTAGGGTTTCCTC
JMSF013A16+ GGAAATCTAGGGTTTCCTCTCGGTTGGGAAGAGTCCCTCTGGCCTGCACCTCTTAATATC
                      ____________________________________________________________
consensus GGAAATCTAGGGTTTCCTCTCGGTTGGGAAGAGTCCCTCTGGCCTGCACCTCTTAATATC