Previous Contig 005359:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS114B06Sequence555005359 (2)
JMSF012P11Sequence453005359 (2)152008221 (3)pir|D96499|D964990.008probable UDP-glucose,sterol glucosyltransferase [imported] - Arabidopsis thalian

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS114B06+ TCACCACACCACCAACTCAA
                      ____________________________________________________________
consensus TCACCACACCACCAACTCAA
 
. : . : . : . : . : . :
JMFS114B06+ AACCCTCTACAAACTACTTCCTAGCTTTCCAAACTTGTAAATTTACTCAATAAATAAACC
                      ____________________________________________________________
consensus AACCCTCTACAAACTACTTCCTAGCTTTCCAAACTTGTAAATTTACTCAATAAATAAACC
 
. : . : . : . : . : . :
JMFS114B06+ AGAACCCACCAAAAGAATTGAGTACCACCAAGAACGACTATTTACATAATATATCCATAA
                      ____________________________________________________________
consensus AGAACCCACCAAAAGAATTGAGTACCACCAAGAACGACTATTTACATAATATATCCATAA
 
. : . : . : . : . : . :
JMFS114B06+ AACAAGAAAACTTGAGCAAACACAGTTCCACAGAATTGAAATCCCTAACAAATCCAACCT
                      ____________________________________________________________
consensus AACAAGAAAACTTGAGCAAACACAGTTCCACAGAATTGAAATCCCTAACAAATCCAACCT
 
. : . : . : . : . : . :
JMFS114B06+ TTTATAGCAATAATAATAATTCAAAGTACCAGCAAATATTAAGCCATAAGAAGAATACCA
                      ____________________________________________________________
consensus TTTATAGCAATAATAATAATTCAAAGTACCAGCAAATATTAAGCCATAAGAAGAATACCA
 
. : . : . : . : . : . :
JMFS114B06+ GCCACAATGTAAAGGCTCAGTACCCAAGCTCACTATACAAAAAACTACACGTCAAATCAA
                      ____________________________________________________________
consensus GCCACAATGTAAAGGCTCAGTACCCAAGCTCACTATACAAAAAACTACACGTCAAATCAA
 
. : . : . : . : . : . :
JMFS114B06+ TCTTCGAGCATTTGGTGTAGCCAAGTCTGAAACGCAACAAAACTTGAAGAAAATCCGCAA
JMSF012P11+ TGAAACGCAACAAAACTTGAAGANAATCNGCAA
                      ____________________________________________________________
consensus TCTTCGAGCATTTGGTGTAGCCAAGTCTGAAACGCAACAAAACTTGAAGAAAATCCGCAA
 
. : . : . : . : . : . :
JMFS114B06+ AAGGACCACACATTTTTCCACGCAAATCACTCAACAAAAGCATAAACAATAGCTAAGGCA
JMSF012P11+ AAGGACCACACATTTTTCCACGCAAATCACTCAACAAAAGCATAAACAATAGCTAAGGCA
                      ____________________________________________________________
consensus AAGGACCACACATTTTTCCACGCAAATCACTCAACAAAAGCATAAACAATAGCTAAGGCA
 
. : . : . : . : . : . :
JMFS114B06+ GTGGGGCAGCTCCATGTGCCCC
JMSF012P11+ GTGGGGCAGNTCCATGTGCCCCTGCGAACACAGAAACGCAGTACATGCGTGTTTTAGCAG
                      ____________________________________________________________
consensus GTGGGGCAGCTCCATGTGCCCCTGCGAACACAGAAACGCAGTACATGCGTGTTTTAGCAG
 
. : . : . : . : . : . :
JMSF012P11+ CTGAAAAAGACTTGAAATTAGGAAATTGAACGAGAATTNTAAGAACGCAATGAACTGTAC
                      ____________________________________________________________
consensus CTGAAAAAGACTTGAAATTAGGAAATTGAACGAGAATTNTAAGAACGCAATGAACTGTAC
 
. : . : . : . : . : . :
JMSF012P11+ TCNGGTGCCCAGTGATAATCATTGGATCNCAAGGGGAAAAAAAACAAAAACAAAANCAAA
                      ____________________________________________________________
consensus TCNGGTGCCCAGTGATAATCATTGGATCNCAAGGGGAAAAAAAACAAAAACAAAANCAAA
 
. : . : . : . : . : . :
JMSF012P11+ AAGTGTGAATTTCAAAAAAAAGTTATAACCGAAAAGAGGNAAGTGACAGGCTGACGACAG
                      ____________________________________________________________
consensus AAGTGTGAATTTCAAAAAAAAGTTATAACCGAAAAGAGGNAAGTGACAGGCTGACGACAG
 
. : . : . : . : . : . :
JMSF012P11+ AGGTTTNCCAGCATGGAAAAAAACCCTAGGGGGAGAAGAATCGTTTTGGAGGGAAGTTAA
                      ____________________________________________________________
consensus AGGTTTNCCAGCATGGAAAAAAACCCTAGGGGGAGAAGAATCGTTTTGGAGGGAAGTTAA
 
. : . : . : . : . : . :
JMSF012P11+ CGTAGTAGGAAGGTGCACAACTGCACTGCACTGCACGAGAACCATCAACAAACTGATCTC
                      ____________________________________________________________
consensus CGTAGTAGGAAGGTGCACAACTGCACTGCACTGCACGAGAACCATCAACAAACTGATCTC