Previous Contig 005356:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS101G08Sequence608005356 (6)gb:AY093052_15750066e-90Arabidopsis thaliana unknown protein (At3g57410) mRNA, complete cds.>gb:AY128932
JMSF003K08Sequence310004536 (9)167005356 (6)
JMSF004H24Sequence280005356 (6)gb:AK176493_18184810.001Arabidopsis thaliana mRNA, complete cds, clone: RAFL24-31-C18.
JMSF012P06Sequence458005356 (6)741005356 (6)sp|O81645|VIL3_ARATH6e-15Villin 3.>pir|T50668|T50668 villin 3 [imported] - Arabidopsis thaliana>gb:AF0812
JMSF044N13Sequence729005356 (6)gb:AK176493_18184812e-07Arabidopsis thaliana mRNA, complete cds, clone: RAFL24-31-C18.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF012P06- ATCATCATCCAGTC
                      ____________________________________________________________
consensus ATCATCATCCAGTC
 
. : . : . : . : . : . :
rJMSF012P06- ATAATACTAAAAAAAACAATTCTACGAACCAAGTCTAAATGATTACAACGTCAAATTATA
                      ____________________________________________________________
consensus ATAATACTAAAAAAAACAATTCTACGAACCAAGTCTAAATGATTACAACGTCAAATTATA
 
. : . : . : . : . : . :
rJMSF012P06- CCTACTCTATATAATTTGATAGAATATCGGCACATTCTGAACGCACCAGATCAATAACCG
                      ____________________________________________________________
consensus CCTACTCTATATAATTTGATAGAATATCGGCACATTCTGAACGCACCAGATCAATAACCG
 
. : . : . : . : . : . :
rJMSF012P06- CTTTGTCATAATCAACTTGTTGAAACTTGCGGCGACCGAGGAGAATGGTGGCGACCGGCG
                      ____________________________________________________________
consensus CTTTGTCATAATCAACTTGTTGAAACTTGCGGCGACCGAGGAGAATGGTGGCGACCGGCG
 
. : . : . : . : . : . :
JMFS101G08+ TGGATTTGAATGAATGTGTTTCATAACCT
rJMSF012P06- AGCTTGCGGTAATGGGCGAAGGGCGAATGAATGGACTTGAATGAATGTGTCTCATAACCT
                      ____________________________________________________________
consensus AGCTTGCGGTAATGGGCGAAGGGCGAATGAATGGATTTGAATGAATGTGTTTCATAACCT
 
. : . : . : . : . : . :
JMFS101G08+ TGAATAAGCCGAGTAATACGCGTTGATTTGGGTCTATTTTGAGAGGCTATGAACTCCTCT
rJMSF012P06- TGAATAAGCCGAGTAATACACATCGATTTGGGTCTATTTTGAGAGTCTATGAACTCCTCT
                      ____________________________________________________________
consensus TGAATAAGCCGAGTAATACGCGTTGATTTGGGTCTATTTTGAGAGTCTATGAACTCCTCT
 
. : . : . : . : . : . :
JMFS101G08+ GCAGCTTGAATAGCAGATTTCCTC-TCATTCACTTGTGTTACACGGCCAACCCAAACAAA
rJMSF012P06- GCAGCTTGAATAGCAGATTTCCTCATCATTCACTTGTGTTACACGGCCAACCCAAAAAAA
                      ____________________________________________________________
consensus GCAGCTTGAATAGCAGATTTCCTCATCATTCACTTGTGTTACACGGCCAACCCAAACAAA
 
. : . : . : . : . : . :
JMFS101G08+ TACCTCATCACCACAATCTAATAAATAGCATCTG
rJMSF003K08- CATCTGAGAAGTATACCATTTTCCATCCTTCC
rJMSF012P06- TACCTTTTCACCACAATCTAATAAATAGCATCTGAGAAGTATACCATTTTCCATCCTTCC
                      ____________________________________________________________
consensus TACCTTTTCACCACAATCTAATAAATAGCATCTGAGAAGTATACCATTTTCCATCCTTCC
 
. : . : . : . : . : . :
rJMSF003K08- AATCCATGTGAGGTCTTAATTCTGAGTGATTGANCACCCTCTCCTT
rJMSF012P06- AATCCATGTGAGGTCTTAATTCTGAGTGATTGAGCAGCCTCTCCTTTCGATGTAGACCTT
JMSF044N13+ TCGATGTAGACCTT
                      ____________________________________________________________
consensus AATCCATGTGAGGTCTTAATTCTGAGTGATTGAGCAGCCTCTCCTTTCGATGTAGACCTT
 
. : . : . : . : . : . :
JMSF004H24+ GGCGTTCTTCTTTTTGGAACCGGATCTTGTAGAGGAAGAAGGAGAAGAA
rJMSF012P06- GGCGTTCCAAAGGCGTTCTTCTTTTTGGAACCGAATCATGTAGTGGAAGAAGGAGAAGAA
JMSF044N13+ GGCGTTCCAAAGGCGTTCTTCTTTTTGGAACCGAATCATGTAGTGGAAGAAGGAGAAGAA
                      ____________________________________________________________
consensus GGCGTTCCAAAGGCGTTCTTCTTTTTGGAACCGAATCATGTAGTGGAAGAAGGAGAAGAA
 
. : . : . : . : . : . :
JMSF004H24+ GAGGGAGGAGGAGGATTAGGGTCAAGAATGACGGCCTCGAACCACGCTCCCGTGAAGCCT
rJMSF012P06- GATGGAGGAGGAGGATTAGGGTCAAGAATGACGGCCCCAAACCACGTTCCCGTGAAGCCT
JMSF044N13+ GATGGAGGAGGAGGATTAGGGTCAAGAATGACGGCCCCAAACCACGTTCCCGTGAAGCCT
JMSF012P06+ CAAGAATGACGGCCCCAAACCACGTTCCCGTGAAGCCT
                      ____________________________________________________________
consensus GATGGAGGAGGAGGATTAGGGTCAAGAATGACGGCCCCAAACCACGTTCCCGTGAAGCCT
 
. : . : . : . : . : . :
JMSF004H24+ TCTTCGTCT
rJMSF012P06- TCTTCGTCTGTGCACACCTCAGGTCCTCAACCAACGACCCCTTGGCTAGTAGCTGCTTCT
JMSF044N13+ TCTTCGTCTGTGCACACCTCAGGTCCTCAACCAACGACCCCTTGGCTAGTAGCTGCTTCT
JMSF012P06+ TCTTCGTCTGTGCACACCTCAGGTCCTCAACCAACGACCCCTTGGCTAGTAGCTGCTTCT
                      ____________________________________________________________
consensus TCTTCGTCTGTGCACACCTCAGGTCCTCAACCAACGACCCCTTGGCTAGTAGCTGCTTCT
 
. : . : . : . : . : . :
rJMSF012P06- GCTAAAATAAAATAGAAAAATTAANTAATTACNAAAACATTTTGTACGTACCTGCTGCGG
JMSF044N13+ GCTAAAATAAAATAGAAAAATTAAATAATTACAAAAACATTTTGTACGTACCTGCTGCGG
JMSF012P06+ GCTAAAATAAAATAGAAAAATTAAATAATTACAAAAACATTTTGTACGTACCTGCTGCGG
                      ____________________________________________________________
consensus GCTAAAATAAAATAGAAAAATTAAATAATTACAAAAACATTTTGTACGTACCTGCTGCGG
 
. : . : . : . : . : . :
rJMSF012P06- AGGCGAC
JMSF044N13+ AGGCGACGACCGAGGAGGAGCTTCGGAGATCTCAATTGAAAGCCATGAAAGTTGAGTTTG
JMSF012P06+ AGGCGACGACCGAGGAGGAGCTTCGGAGATCTCAATTGAAAGCCATGAAAGTTGAGTTTG
                      ____________________________________________________________
consensus AGGCGACGACCGAGGAGGAGCTTCGGAGATCTCAATTGAAAGCCATGAAAGTTGAGTTTG
 
. : . : . : . : . : . :
JMSF044N13+ CAGAAATCGATAATTTTCTGAGATTCCAGATATGAAGAGAGAAAAGAGAGGAGGAATGGT
JMSF012P06+ CAGAAATCGATAATTTTCTGAGATTCCAGATATGAAGAGAGAAAAGAGAGGAGGAATGGT
                      ____________________________________________________________
consensus CAGAAATCGATAATTTTCTGAGATTCCAGATATGAAGAGAGAAAAGAGAGGAGGAATGGT
 
. : . : . : . : . : . :
JMSF044N13+ TAAACCCTAGTATATCTTCTTTCACTTGGAGCTCTGTAATGATTTCTAAACTAAAATGTT
JMSF012P06+ TAAACCCTAGTATATCTTCTTTCACTTGGAGCTCTGTAATGATTTCTAAACTAAAATGTT
                      ____________________________________________________________
consensus TAAACCCTAGTATATCTTCTTTCACTTGGAGCTCTGTAATGATTTCTAAACTAAAATGTT
 
. : . : . : . : . : . :
JMSF044N13+ TTTACTGCGGAGATGGCTAGTGTGGAGAATGGCGGTCGGCGGAGGCGGAGATGTCTGAGG
JMSF012P06+ TTTACTGCGGAGATGGCTAGTGTGGAGAATGGTGGTCGGCGGAGGCGGAGATGTCTGAGG
                      ____________________________________________________________
consensus TTTACTGCGGAGATGGCTAGTGTGGAGAATGGTGGTCGGCGGAGGCGGAGATGTCTGAGG
 
. : . : . : . : . : . :
JMSF044N13+ ACAATGGCGGTTGGTGAAGAGCACTCTGACTGCGAAGATGTCT
JMSF012P06+ ACAATGGCGGTTGGTGAAGAGCACTCTGACTGCGAAGATGTCTGAGGACAATGGTAGTCC
                      ____________________________________________________________
consensus ACAATGGCGGTTGGTGAAGAGCACTCTGACTGCGAAGATGTCTGAGGACAATGGTAGTCC