Previous Contig 005354:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039I21Sequence268005354 (5)666010905 (3)sp|P11043|AROA_PETHY2e-793-phosphoshikimate 1-carboxyvinyltransferase, chloroplast precursor (EC 2.5.1.19
JMFF049G07Sequence425005354 (5)sp|P11043|AROA_PETHY2e-353-phosphoshikimate 1-carboxyvinyltransferase, chloroplast precursor (EC 2.5.1.19318010905 (3)gb:AY545667_16129457e-20Conyza canadensis 5-enol-pyruvylshikimate-phosphate synthase (EPSPS2) gene, comp
JMSF012P02Sequence393005354 (5)776011718 (2)sp|P11043|AROA_PETHY2e-903-phosphoshikimate 1-carboxyvinyltransferase, chloroplast precursor (EC 2.5.1.19
JMSF032M23Sequence651005354 (5)sp|P11043|AROA_PETHY1e-643-phosphoshikimate 1-carboxyvinyltransferase, chloroplast precursor (EC 2.5.1.19584010905 (3)gb:AY545666_16129442e-68Conyza canadensis 5-enol-pyruvylshikimate-phosphate synthase (EPSPS1) gene, comp
JMSF053M17Sequence582005354 (5)907011718 (2)sp|P11043|AROA_PETHYe-1103-phosphoshikimate 1-carboxyvinyltransferase, chloroplast precursor (EC 2.5.1.19

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032M23+ GAACTCCATCAAGTACGTATCTTGCATTTCCACCGGCAGCAACAACTGCAGCAGTCAAT
                      ____________________________________________________________
consensus GAACTCCATCAAGTACGTATCTTGCATTTCCACCGGCAGCAACAACTGCAGCAGTCAAT
 
. : . : . : . : . : . :
JMSF032M23+ GGTCGCATTGCTGTTCCAGCATTTCCCAGGAAAAGTTGAATTTCGTCCGTGGATTGCTTA
                      ____________________________________________________________
consensus GGTCGCATTGCTGTTCCAGCATTTCCCAGGAAAAGTTGAATTTCGTCCGTGGATTGCTTA
 
. : . : . : . : . : . :
JMSF032M23+ CTGGCAGGGAAGAGACCACCCGAACCTTCTACAGTTGCTCGCTGGATTGCGTTATCTTCT
                      ____________________________________________________________
consensus CTGGCAGGGAAGAGACCACCCGAACCTTCTACAGTTGCTCGCTGGATTGCGTTATCTTCT
 
. : . : . : . : . : . :
JMFF049G07+ AAGACCAAGCGTTCTCAATGCACCGAGCATATAATTAATATCATCACTGCTT
JMSF032M23+ TCAACACGAAGACCAAGCGTTCTCAATGCACCGAGCATATAATTAATATCATCACTGCTT
                      ____________________________________________________________
consensus TCAACACGAAGACCAAGCGTTCTCAATGCACCGAGCATATAATTAATATCATCACTGCTT
 
. : . : . : . : . : . :
JMFF049G07+ AGTAAATNGTCTACCACAGTTGTTCCCTGAGAAAGAGCAGCAAGGAGGAGAATGCGATTG
JMSF032M23+ AGTAAATTGTCTACCACAGTTGTTCCCTGAGAAAGAGCAGCAAGGAGGAGAATGCGATTG
                      ____________________________________________________________
consensus AGTAAATTGTCTACCACAGTTGTTCCCTGAGAAAGAGCAGCAAGGAGGAGAATGCGATTG
 
. : . : . : . : . : . :
JMFF049G07+ GAGAGGGATTTAGAGCCGGGCAACTTGACGGTGCCGGAGATCTCTTTGATGGGCTGCAGC
JMSF032M23+ GAGAGGGATTTAGAGCCGGGCAACTTGACGGTGCCGGAGATCTCTTTGATGGGCTGCAGC
                      ____________________________________________________________
consensus GAGAGGGATTTAGAGCCGGGCAACTTGACGGTGCCGGAGATCTCTTTGATGGGCTGCAGC
 
. : . : . : . : . : . :
JMFF049G07+ ACAATCTCCTCCGGCGCCTTCGATGGCTTTTCGGCGGTGACCACCGATGCCCGGACCTGT
JMSF032M23+ ACAATCTCCTCCGGCGCCTTCGATGGCTTTTCGGCGGTGACCACCGATGCCCGGACCTGT
JMSF053M17+ TTCGATGGCTTTTTGGTGGTGGCCACCGATGCCCTGACCTGT
                      ____________________________________________________________
consensus ACAATCTCCTCCGGCGCCTTCGATGGCTTTTCGGCGGTGACCACCGATGCCCGGACCTGT
 
. : . : . : . : . : . :
JMFF049G07+ AACGGCGACCGGGTGGCAATAAAAATCGAATCTTTATTACTCTTCAAGAACTTAACAGAA
JMSF032M23+ AACGGCGACCGGGTGGCAATAAAAATCGAATCTTTATTACTCTTCAAGAACTTAACAGAA
JMFF039I21+ TTCAAGAACTTAACAGAA
JMSF053M17+ AACGGCAACCGGGTGGCAGTAAAAATCGAATCTTTATTACTCTTCAAGAACTTAACAGAA
                      ____________________________________________________________
consensus AACGGCGACCGGGTGGCAATAAAAATCGAATCTTTATTACTCTTCAAGAACTTAACAGAA
 
. : . : . : . : . : . :
JMFF049G07+ ACAGGTGAATTCTTCAGGCTGCTTGACCCCAACAAAAGGGAATGCGAAGACAGAGGGGTT
JMSF032M23+ ACAGGTGAATTCTTCAGGCTGCTTGACCCCAACAAAAGGGAATGCGAAGACAGAGGGGTT
JMFF039I21+ ACAGGTGAATTCTTCAGGCTGCTTGACCCCAACAAAAGGGAATGCGAAGACAGAGGGGTT
JMSF053M17+ ACAGCTGATTTCTTCAGGCTGCTCGACCCCAACAAAAGCGACCGCGAAGGCAGAGGGGTC
                      ____________________________________________________________
consensus ACAGGTGAATTCTTCAGGCTGCTTGACCCCAACAAAAGGGAATGCGAAGACAGAGGGGTT
 
. : . : . : . : . : . :
JMFF049G07+ TGAGGTTTAGACAGATTTCTGGGATTCAAACGCTGACCCTGCATCATG
JMSF032M23+ TGAGGTTTAGACAGATTTCTGGGATTCAAACGCTGACCCTGCATCATG
JMFF039I21+ TGAGGTTTAGACAGATTTCTGGGATTCAAACGCTGACCCTGCATCATG
JMSF053M17+ TGAGGTTTGGATAGATTGGTGGGATTCAAACGCAGACCCTGCATCATGTGTGCCATATCC
JMSF012P02+ AAACGCAGACCCTGCATCATGTGTGCCATATCC
                      ____________________________________________________________
consensus TGAGGTTTAGACAGATTTCTGGGATTCAAACGCTGACCCTGCATCATGTGTGCCATATCC
 
. : . : . : . : . : . :
JMSF053M17+ TCCCACTGCACAGAGCTTGAGACCTTTCAATTGAATTTGGTAGGTGGGTAGCTTGAAAGG
JMSF012P02+ TCCCACTGCACAGAGCTTGAGACCTTTCAATTGAATTTGGTAGGTGGGTAGCTTGAAAGG
                      ____________________________________________________________
consensus TCCCACTGCACAGAGCTTGAGACCTTTCAATTGAATTTGGTAGGTGGGTAGCTTGAAAGG
 
. : . : . : . : . : . :
JMSF053M17+ GGTGAATCAGAGAGTAGCGTGGCGACAAGAACTTGTATTAGTACAATCCCTCTCAACAAC
JMSF012P02+ GGTGAATCAGAGAGTAGCGTGGCGACAAGAACTTGTATTAGTACAATCCCTCTCAACAAC
                      ____________________________________________________________
consensus GGTGAATCAGAGAGTAGCGTGGCGACAAGAACTTGTATTAGTACAATCCCTCTCAACAAC
 
. : . : . : . : . : . :
JMSF053M17+ CCACTTCTGGTTGAGCAGGTGGACTCGTTTTATCTTTTGAACCTTAGAGTCACACTGACT
JMSF012P02+ CCACTTCTGGTTGAGCAGGTGGACTCGTTTTATCTTTTGAACCTTAGAGTCACACTGACT
                      ____________________________________________________________
consensus CCACTTCTGGTTGAGCAGGTGGACTCGTTTTATCTTTTGAACCTTAGAGTCACACTGACT
 
. : . : . : . : . : . :
JMSF053M17+ GACTCAGTGAAGCAGAGACGGGCTGAGGTGAGGCCCGCAGAGCCGCTGAGTCGATGAAGT
JMSF012P02+ GACTCAGTGAAGCAGAGACGGGCTGAGGTGAGGCCCGCAGAGCCGCTGAGTCGATGAAGT
                      ____________________________________________________________
consensus GACTCAGTGAAGCAGAGACGGGCTGAGGTGAGGCCCGCAGAGCCGCTGAGTCGATGAAGT
 
. : . : . : . : . : . :
JMSF053M17+ GAGGTCTGACGGCGAGGGTGGACCAGAGGCGGTGAGAGACGACGGAGAGAACCGTCGTCG
JMSF012P02+ GAGGTCTGACGGCGAGGGCGGACCAGAGGCGGTGAGAGACGACGGAGAGAACCATCGTCG
                      ____________________________________________________________
consensus GAGGTCTGACGGCGAGGGTGGACCAGAGGCGGTGAGAGACGACGGAGAGAACCGTCGTCG
 
. : . : . : . : . : . :
JMSF053M17+ AAGAGAATGTGTCTGCGCAGACCTTTGAATTGAATTTGGTAGATTGAAAGGGGTGAATCC
JMSF012P02+ AAGAGAATGTGTCTGCGCAGACCTTTGAATTGAATTTGGTAGATTGAAAGGGGTGAATCC
                      ____________________________________________________________
consensus AAGAGAATGTGTCTGCGCAGACCTTTGAATTGAATTTGGTAGATTGAAAGGGGTGAATCC