Previous Contig 005343:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013P06Sequence526005343 (4)732012783 (8)
JMSF012M21Sequence468005343 (4)742012783 (8)
JMSF031H03Sequence670005343 (4)gb:AY048595_5866550.010Staphylococcus caprae strain 96007 serine-aspartate repeat protein (sdrZ) gene, 760012783 (8)
JMSF048P08Sequence706005343 (4)gb:AY048595_5866550.003Staphylococcus caprae strain 96007 serine-aspartate repeat protein (sdrZ) gene, 767012783 (8)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048P08+ ACCTCCATTAGGACGATTTGGCTCAAAAGGTCGACCGTTGTGACTT
JMSF031H03+ GTTGTGACTT
                      ____________________________________________________________
consensus ACCTCCATTAGGACGATTTGGCTCAAAAGGTCGACCGTTGTGACTT
 
. : . : . : . : . : . :
JMSF048P08+ GGGGGAGACTCATCACGGCTCATCCAAGAAGCCCTGCTACCCCAATTGGGACGATCAAAA
JMSF031H03+ GGGGGAGACTCATCACGGCTCATCCAAGAAGCCCTGCTACCCCAATTGGGACGATCAAAA
                      ____________________________________________________________
consensus GGGGGAGACTCATCACGGCTCATCCAAGAAGCCCTGCTACCCCAATTGGGACGATCAAAA
 
. : . : . : . : . : . :
JMSF048P08+ TGCCCATTGTTGTTGTGCCTAGGAGGAGACTCATCATGGCTCATCCAAGAACCCCTACTA
JMSF031H03+ TGCCCATTGTTGTTGTGCCTAGGAGGAGACTCATCATGGCTCATCCAAGAACCCCTACTA
                      ____________________________________________________________
consensus TGCCCATTGTTGTTGTGCCTAGGAGGAGACTCATCATGGCTCATCCAAGAACCCCTACTA
 
. : . : . : . : . : . :
JMSF048P08+ CCCCAATTGGCACCATTTTGGCTATGCCAATTAGGGTTGGCTCCCAAATTGTGACCAACT
JMFF013P06+ CATTTTGGCTATGCCAATTAGGGTTGGCTCCCAAATTGTGACCAACT
JMSF031H03+ CCCCAATTGGCACCATTTTGGCTATGCCAATTAGGGTTGGCTCCCAAATTGTGACCAACT
                      ____________________________________________________________
consensus CCCCAATTGGCACCATTTTGGCTATGCCAATTAGGGTTGGCTCCCAAATTGTGACCAACT
 
. : . : . : . : . : . :
JMSF048P08+ GGACGGCTAAGAATTGGAGCACCTGGCTGCATGCTGGCCTCCATCTGAACTTGGTTGAAG
JMFF013P06+ GGACGGCTAAGAATTGGAGCACCTGGCTGCATGCTGGCCTCCATCTGAACTTGGTTGAAG
JMSF031H03+ GGACGGCTAAGAATTGGAGCACCTGGCTGCATGCTGGCCTCCATCTGAACTTGGTTGAAG
JMSF012M21+ GGAGCACCTGGCTGCATGCTGGCCTCCATCTGAACTTGGTTGAAG
                      ____________________________________________________________
consensus GGACGGCTAAGAATTGGAGCACCTGGCTGCATGCTGGCCTCCATCTGAACTTGGTTGAAG
 
. : . : . : . : . : . :
JMSF048P08+ AAATCTTTAACTTTCCCAAGTCTATCAAGATTCTCCTTGAGGCCGCCATTACCATCTTCA
JMFF013P06+ AAATCTTTAACTTTCCCAAGTCTATCAAGATTCTCCTTGAGGCCGCCATTACCATCTTCA
JMSF031H03+ AAATCTTTAACTTTCCCAAGTCTATCAAGATTCTCCTTGAGGCCGCCATTACCATCTTCA
JMSF012M21+ AAATCTTTAACTTTCCCAAGTCTATCAAGATTCTCCTTGAGGCCGCCATTACCATCTTCA
                      ____________________________________________________________
consensus AAATCTTTAACTTTCCCAAGTCTATCAAGATTCTCCTTGAGGCCGCCATTACCATCTTCA
 
. : . : . : . : . : . :
JMSF048P08+ TAAGCACCAACAATTCTTTCCTCCCTCACGGGCTTACCATTGATAAGAACTCGACGAGTG
JMFF013P06+ TAAGCACCAACAATTCTTTCCTCCCTCACGGGCTTACCATTGATAAGAACTCGACGAGTG
JMSF031H03+ TAAGCACCAACAATTCTTTCCTCCCTCACGGGCTTACCATTGATAAGAACTCGACGAGTG
JMSF012M21+ TAAGCACCAACAATTCTTTCCTCCCTCACGGGCTTACCATTGATAAGAACTCGACGAGTG
                      ____________________________________________________________
consensus TAAGCACCAACAATTCTTTCCTCCCTCACGGGCTTACCATTGATAAGAACTCGACGAGTG
 
. : . : . : . : . : . :
JMSF048P08+ ACCACAGGCCTCACAACCTCAACAACCCTTTGGGTCTTCACTACATAGTTGTTTAAGCCC
JMFF013P06+ ACCACAGGCCTCACAACCTCAACAACCCTTTGGGTCTTCACTACATAGTTGTTTAAGCCC
JMSF031H03+ ACCACAGGCCTCACAACCTCAACAACCCTTTGGGTCTTCACTACATAGTTGTTTAAGCCC
JMSF012M21+ ACCACAGGCCTCACAACCTCAACAACCCTTTGGGTCTTCACTACATAGTTGTTTAAGCCC
                      ____________________________________________________________
consensus ACCACAGGCCTCACAACCTCAACAACCCTTTGGGTCTTCACTACATAGTTGTTTAAGCCC
 
. : . : . : . : . : . :
JMSF048P08+ TCGGCGTTAGGATAGGTAGTCATCATGGAGCTTTTCCTTTGCCCACCATCAACCATGAAC
JMFF013P06+ TCGGCGTTAGGATAGGTAGTCATCATGGAGCTTTTCCTTTGCCCACCATCAACCATGAAC
JMSF031H03+ TCGGCGTTAGGATAGGTAGTCATCATGGAGCTTTTCCTTTGCCCACCATCAACCATGAAC
JMSF012M21+ TCGGCGTTAGGATAGGTAGTCATCATGGAGCTTTTCCTTTGCCCACCATCAACCATGAAC
                      ____________________________________________________________
consensus TCGGCGTTAGGATAGGTAGTCATCATGGAGCTTTTCCTTTGCCCACCATCAACCATGAAC
 
. : . : . : . : . : . :
JMSF048P08+ GCCGGTTGGCTTCGCATATGGTCTTCATATGGATACTCATCATCATGCCCCAGTTTGCCA
JMFF013P06+ GCCGGTTGGCTTCGCATATGGTCTTCATATGGATACTCATCATCATGCCCCAGTTTGCCA
JMSF031H03+ GCCGGTTGGCTTCGCATATGGTCTTCATATGGATACTCATCATCATGCCCCAGTTTGCCA
JMSF012M21+ GCCGGTTGGCTTCGCATATGGTCTTCATATGGATACTCATCATCATGCCCCAGTTTGCCA
                      ____________________________________________________________
consensus GCCGGTTGGCTTCGCATATGGTCTTCATATGGATACTCATCATCATGCCCCAGTTTGCCA
 
. : . : . : . : . : . :
JMSF048P08+ TTATCAGAAAAACCCATTGATATGATCAATCAATAGGCCGGCTAGAATATATATTAAAAC
JMFF013P06+ TTATCAGAAAAACCCATTGATATGATCAATCAATAGGCCGGCTAGAATATATATTAAAAC
JMSF031H03+ TTATCAGAAAAACCCATTGATATGATCAATCAATAGGCCGGCTAGAATATATATTAAAAC
JMSF012M21+ TTATCAGAAAAACCCATTGATATGATCAATCAATAGGCCGGCTAGAATATATATTAAAAC
                      ____________________________________________________________
consensus TTATCAGAAAAACCCATTGATATGATCAATCAATAGGCCGGCTAGAATATATATTAAAAC
 
. : . : . : . : . : . :
JMSF048P08+ TAGTATTACTTCTTTAAGAAAGTTGTTGATTTGGATTTCTTTCTTGTTTGGATGATGCT
JMFF013P06+ TAGTATTACTTCTTTAAGAAAGTTGTTGATTTGGATTTCTTTCTTGTTTGGATGATGCT
JMSF031H03+ TAGTATTACTTCTTTAAGAAAGTTGTTGATTTGGATTTCTTTCTTGTTTGGATGATGCT
JMSF012M21+ TAGTATTACTTCTTTAAGAAAGTTGTTGATTTGGATTTCTTTCTTGTTTGGATGATGCTC
                      ____________________________________________________________
consensus TAGTATTACTTCTTTAAGAAAGTTGTTGATTTGGATTTCTTTCTTGTTTGGATGATGCTC