Previous Contig 005341:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029L02Sequence427005341 (3)gb:AC123513_11924107e-26Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN798008738 (8)gb:AB022223_15151754e-98Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MWI23.>gb:AY035004_155
JMFF041N19Sequence641005341 (3)gb:AC123513_11924102e-25Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN642008738 (8)gb:AB022223_15151752e-68Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MWI23.>gb:AY035004_155
JMSF012M06Sequence465005341 (3)gb:AC123513_11924108e-26Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN773008738 (8)gb:AB022223_15151757e-96Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MWI23.>gb:AY035004_155

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF041N19+ TACCGCGATAAACCGTGCCATAGGTGCCTTGAGCAATAAGATAC
                      ____________________________________________________________
consensus TACCGCGATAAACCGTGCCATAGGTGCCTTGAGCAATAAGATAC
 
. : . : . : . : . : . :
JMFF041N19+ CTAATCTCCAATTTCAAAGGATCAATCTCCCAGTCCTCCTTGGGCCTCTGGACTTGATGT
                      ____________________________________________________________
consensus CTAATCTCCAATTTCAAAGGATCAATCTCCCAGTCCTCCTTGGGCCTCTGGACTTGATGT
 
. : . : . : . : . : . :
JMFF041N19+ TCTACACTCCTAGACCAAACCCGACTCAGATGCTTCTCCAATTGAACATCCAAGCTTTTG
                      ____________________________________________________________
consensus TCTACACTCCTAGACCAAACCCGACTCAGATGCTTCTCCAATTGAACATCCAAGCTTTTG
 
. : . : . : . : . : . :
JMFF041N19+ AGATCAATCTTATCAGCCCTAAAAATCATATCTTTGCTAGGGCTCTTCCCTGCCATATTT
JMFF029L02+ GCCATATTT
JMSF012M06+ AGCCCTAAAAATCATATCTTTGCTAGGGCTCTTCCCTGCCATATTT
                      ____________________________________________________________
consensus AGATCAATCTTATCAGCCCTAAAAATCATATCTTTGCTAGGGCTCTTCCCTGCCATATTT
 
. : . : . : . : . : . :
JMFF041N19+ CCATCACTAATACT-CCCTGGCCCCTTCAACTTAGACCCTAATTCCCCTTCTGGATGCCC
JMFF029L02+ CCATCACTAATACTCCCCTGGCCCCTTCAACTTAGACCCTAATTCCCCTTCTGGATGCCC
JMSF012M06+ CCATCACTAATACT-CCCTGGCCCCTTCAACTTAGACCCTAATTCCCCTTCTGGATGCCC
                      ____________________________________________________________
consensus CCATCACTAATACT-CCCTGGCCCCTTCAACTTAGACCCTAATTCCCCTTCTGGATGCCC
 
. : . : . : . : . : . :
JMFF041N19+ TGAATAGTCCCCTTTGGGCACCTCACCACCATCAACACTTGTTCTCAAATCCATATTTAT
JMFF029L02+ TGAATAGTCCCCTTTGGGCACCTCACCACCATCAACACTTGTTCTCAAATCCATATTTAT
JMSF012M06+ TGAATAGTCCCCTTTGGGCACCTCACCACCATCAACACTTGTTCTCAAATCCATATTTAT
                      ____________________________________________________________
consensus TGAATAGTCCCCTTTGGGCACCTCACCACCATCAACACTTGTTCTCAAATCCATATTTAT
 
. : . : . : . : . : . :
JMFF041N19+ TAAATCAGTCCAACAACCCCCACAAAGGTTCAATCTTTAAAGAATTTTTTTAAGAAGATC
JMFF029L02+ TAAATCAGTCCAACAACCCCCACAAAGGTTCAATCTTTAAAGAATTTTTTTAAGAAGATC
JMSF012M06+ TAAATCAGTCCAACAACCCCCACAAAGGTTCAATCTTTAAAGAATTTTTTTAAGAAGATC
                      ____________________________________________________________
consensus TAAATCAGTCCAACAACCCCCACAAAGGTTCAATCTTTAAAGAATTTTTTTAAGAAGATC
 
. : . : . : . : . : . :
JMFF041N19+ AAAACAGAAATAAAATCAATGAAAAACAAGCTAATCTTTTTGCTGGAACTCTATCAAATT
JMFF029L02+ AAAACAGAAATAAAATCAATGAAAAACAAGCTAATCTTTTTGCTGGAACTCTATCAAATT
JMSF012M06+ AAAACAGAAATAAAATCAATGAAAAACAAGCTAATCTTTTTGCTGGAACTCTATCAAATT
                      ____________________________________________________________
consensus AAAACAGAAATAAAATCAATGAAAAACAAGCTAATCTTTTTGCTGGAACTCTATCAAATT
 
. : . : . : . : . : . :
JMFF041N19+ GATCAGAAAAGATCTAAGAACTTATCATCATCATCATCATCAAAGAGAGGTCATCTCAAT
JMFF029L02+ GATCAGAAAAGATCTAAGAACTTATCATCATCATCATCATCAAAGAGAGGTCATCTCAAT
JMSF012M06+ GATCAGAAAAGATCTAAGAACTTATCATCATCATCATCATCAAAGAGAGGTCATCTCAAT
                      ____________________________________________________________
consensus GATCAGAAAAGATCTAAGAACTTATCATCATCATCATCATCAAAGAGAGGTCATCTCAAT
 
. : . : . : . : . : . :
JMFF041N19+ GATTCTCAATGTGCAGAAAATCTTCAAAAACAAAAAACCTGAGAAATAAACAAAGGAAGT
JMFF029L02+ GATTCTCAATGTGCAGAAAATCTTCAAAAACAAAAAACCTGAGAAATAAACAAAGGAAGT
JMSF012M06+ GATTCTCAATGTGCAGAAAATCTTCAAAAACAAAAAACCTGAGAAATAAACAAAGGAAGT
                      ____________________________________________________________
consensus GATTCTCAATGTGCAGAAAATCTTCAAAAACAAAAAACCTGAGAAATAAACAAAGGAAGT
 
. : . : . : . : . : . :
JMFF041N19+ CCCAATTCCGACTCGGGCTTGTTTCCCAGTTCTGACCCAGAGCAGAAAAGGGAAAA
JMFF029L02+ CCCAATTCCGACTCGGGCTTGTTTCCCAGTTCTGACCCAGAGCAGAAAAGGGAAAA
JMSF012M06+ CCCAATTCCGACTCGGGCTTGTTTCCCAGTTCTGACCCAGAGCAGAAAAGGGAAAAACCC
                      ____________________________________________________________
consensus CCCAATTCCGACTCGGGCTTGTTTCCCAGTTCTGACCCAGAGCAGAAAAGGGAAAAACCC