Previous Contig 005332:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN010C20Sequence587005332 (8)gb:AP005441_18517952e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFN016J23Sequence583005332 (8)gb:AP005441_18517952e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFN016L21Sequence595005332 (8)gb:AP005441_18517952e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFN028J08Sequence575005332 (8)gb:AP005441_18517952e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFN039L07Sequence579005332 (8)gb:AP005441_18517952e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFS109A11Sequence599005332 (8)gb:AP005441_18517953e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMSF012K14Sequence201005332 (8)655005332 (8)gb:AP005441_18517951e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS109A11- TCTCGAGTTTTTTTTTTTTTTTT
                      ____________________________________________________________
consensus TCTCGAGTTTTTTTTTTTTTTTT
 
. : . : . : . : . : . :
JMFS109A11- TTGCAAGCAAATGTAGCTTTCTAAGAAATCAAGAGTGAATCCATTTTTTGTCGTTTTGAG
JMFN039L07+ AAGAAATCAAGAGTGAATCCATTTTTTGTCGTTTTGAG
JMFN010C20+ TTTCTAAGAAATCAAGAGTGAATCCATTTTTTGTCGTTTTGAG
JMFN028J08+ TCAAGAGTGAATCCATTTTTTGTCGTTGTGAG
JMFN016L21+ TTTCTAAGAAATCAAGAGTGAATCCATTTTTTGTCGTTNTGAG
JMFN016J23+ AAGAAATCAAGAGTGAATCCATTNTTTGTCGTTTTGAG
rJMSF012K14- CATTTTTTGTCGTTTTGAG
                      ____________________________________________________________
consensus TTGCAAGCAAATGTAGCTTTCTAAGAAATCAAGAGTGAATCCATTTTTTGTCGTTTTGAG
 
. : . : . : . : . : . :
JMFS109A11- TTGATTTACAACGGTCCATATCGAATTGGTCCTTTTTTTTTTTAATCTTCTAAAGCAAAG
JMFN039L07+ TTGATTTACAACGGTCCATATCGAATTGGTCC-TTTTTTTTTTAATCTTCTAAAGCAAAG
JMFN010C20+ TTGATTTACAACGGTCCATATCGAATTGGTCC-TTTTTTTTTTAATCTTCTAAAGCAAAG
JMFN028J08+ TTGATTTACAACGGTCCATATCGAATTGGTCC-TTTTTTTTTTAATCTTCTAAAGCAAAG
JMFN016L21+ TTGATTTACAACGGTCCATATCGAATTGGTCC-TTTTTTTTTTAATCTTCTAAAGCAAAG
JMFN016J23+ TTGATTTACAACGGTCCATATCGAATTGGTCC-TTTTTTTTTTAATCTTCTAAAGCAAAG
rJMSF012K14- TTGATTTACAACGGTCCATATCGAATTGGTCCTTTTTTTTTTTAATCTTCTAAAGCAAAG
                      ____________________________________________________________
consensus TTGATTTACAACGGTCCATATCGAATTGGTCC-TTTTTTTTTTAATCTTCTAAAGCAAAG
 
. : . : . : . : . : . :
JMFS109A11- GATTTACAGTTGTGAGTTTCCATGTAGAGTTTATTAACCTTCTTTCTAGCTAGTCGCACC
JMFN039L07+ GATTTACAGTTGTGAGTTTCCATGTAGAGTTTATTAACCTTCTTTCTAGCTAGTCGCACC
JMFN010C20+ GATTTACAGTTGTGAGTTTCCATGTAGAGTTTATTAACCTTCTTTCTAGCTAGTCGCACC
JMFN028J08+ GATTTACAGTTGTGAGTTTCCATGTAGAGTTTATTAACCTTCTTTCTAGCTAGTCGCACC
JMFN016L21+ GATTTACAGTTGTGAGTTTCCATGTAGAGTTTATTAACCTTCTTTCTAGCTAGTCGCACC
JMFN016J23+ GATTTACAGTTGTGAGTTTCCATGTAGAGTTTATTAACCTTCTTTCTAGCTAGTCGCACC
rJMSF012K14- GATTTACAGTTGGGAGTTTCCANGTANAGTTTATTAACCTTCTTTCTAGCTAGTCGCACC
                      ____________________________________________________________
consensus GATTTACAGTTGTGAGTTTCCATGTAGAGTTTATTAACCTTCTTTCTAGCTAGTCGCACC
 
. : . : . : . : . : . :
JMFS109A11- CGAAGGTGTTCTCCCCGCTGTAAGTCATGTAAAGGAAGCCATCTTCATCCTTGTGCTCCT
JMFN039L07+ CGAAGGTGTTCTCCCCGCTGTAAGTCATGTAAAGGAAGCCATCTTCATCCTTGTGCTCCT
JMFN010C20+ CGAAGGTGTTCTCCCCGCTGTAAGTCATGTAAAGGAAGCCATCTTCATCCTTGTGCTCCT
JMFN028J08+ CGAAGGTGTTCTCCCCGCTGTAAGTCATGTAAAGGAAGCCATCTTCATCCTTGTGCTCCT
JMFN016L21+ CGAAGGTGTTCTCCCCGCTGTAAGTCATGTAAAGGAAGCCATCTTCATCCTTGTGCTCCT
JMFN016J23+ CGAAGGTGTTCTCCCCGCTGTAAGTCATGTAAAGGAAGCCATCTTCATCCTTGTGCTCCT
rJMSF012K14- CNAAGGGGTTCNCCCCGCTGTAAGTCANGTAAAGGAAGCCATCTTCATCCTNGGGCTCCT
                      ____________________________________________________________
consensus CGAAGGTGTTCTCCCCGCTGTAAGTCATGTAAAGGAAGCCATCTTCATCCTTGTGCTCCT
 
. : . : . : . : . : . :
JMFS109A11- CGTAAATTGCAGACATCAATGCAGCGGTTGGTGGCAGCATGTTCTTAACAAAGACAAATA
JMFN039L07+ CGTAAATTGCAGACATCAATGCAGCGGTTGGTGGCAGCATGTTCTTAACAAAGACAAATA
JMFN010C20+ CGTAAATTGCAGACATCAATGCAGCGGTTGGTGGCAGCATGTTCTTAACAAAGACAAATA
JMFN028J08+ CGTAAATTGCAGACATCAATGCAGCGGTTGGTGGCAGCATGTTCTTAACAAAGACAAATA
JMFN016L21+ CGTAAATTGCAGACATCAATGCAGCGGTTGGTGGCAGCATGTTCTTAACAAAGACAAATA
JMFN016J23+ CGTAAATTGCAGACATCAATGCAGCGGTTGGTGGCAGCATGTTCTTAACAAAGACAAATA
rJMSF012K14- CGNAAATTGCAAACATCAANGCANCGGTNGGGGGCAGCANGTTCTTAACAAANACAAATA
                      ____________________________________________________________
consensus CGTAAATTGCAGACATCAATGCAGCGGTTGGTGGCAGCATGTTCTTAACAAAGACAAATA
 
. : . : . : . : . : . :
JMFS109A11- TTGCCTTCTCGGCGCTGAGCTTGATCCTTTTTCGAACAACATACACAAACTGGCCAACAG
JMFN039L07+ TTGCCTTCTCGGCGCTGAGCTTGATCCTTTTTCGAACAACATACACAAACTGGCCAACAG
JMFN010C20+ TTGCCTTCTCGGCGCTGAGCTTGATCCTTTTTCGAACAACATACACAAACTGGCCAACAG
JMFN028J08+ TTGCCTTCTCGGCGCTGAGCTTGATCCTTTTTCGAACAACATACACAAACTGGCCAACAG
JMFN016L21+ TTGCCTTCTCGGCGCTGAGCTTGATCCTTTTTCGAACAACATACACAAACTGGCCAACAG
JMFN016J23+ TTGCCTTCTCGGCGCTGAGCTTGATCCTTTTTCGAACAACATACACAAACTGGCCAACAG
rJMSF012K14- TNGCCTTCNCGGCGCTNAGCTTGATCCTTTTTCNAACAACATACACAAACNGGCCAACAG
                      ____________________________________________________________
consensus TTGCCTTCTCGGCGCTGAGCTTGATCCTTTTTCGAACAACATACACAAACTGGCCAACAG
 
. : . : . : . : . : . :
JMFS109A11- TCAGGTCTGCGGGAACAAGGTATTTTTTCTTGTCGATATCAGGAATGTCGCTCCTTTCTG
JMFN039L07+ TCAGGTCTGCGGGAACAAGGTATTTTTTCTTGTCGATATCAGGAATGTCGCTCCTTTCTG
JMFN010C20+ TCAGGTCTGCGGGAACAAGGTATTTTTTCTTGTCGATATCAGGAATGTCGCTCCTTTCTG
JMFN028J08+ TCAGGTCTGCGGGAACAAGGTATTTTTTCTTGTCGATATCAGGAATGTCGCTCCTTTCTG
JMFN016L21+ TCAGGTCTGCGGGAACAAGGTATTTTTTCTTGTCGATATCAGGAATGTCGCTCCTTTCTG
JMFN016J23+ TCAGGTCTGCGGGAACAAGGTATTTTTTCTTGTCGATATCAGGAATGTCGCTCCTTTCTG
rJMSF012K14- TCAGGTCTGCGGGAACAAGGNATTTTTTCTNGNCNATATCAGGAANGTCGCTCCTTTCNG
                      ____________________________________________________________
consensus TCAGGTCTGCGGGAACAAGGTATTTTTTCTTGTCGATATCAGGAATGTCGCTCCTTTCTG
 
. : . : . : . : . : . :
JMFS109A11- CTTTTTCAACAATCACGGGAATTCTTTCAGGATACTTCTCCCGGATGCGAGTAGATTCTG
JMFN039L07+ CTTTTTCAACAATCACGGGAATTCTTTCAGGATACTTCTCCCGGATGCGAGTAGATTCTG
JMFN010C20+ CTTTTTCAACAATCACGGGAATTCTTTCAGGATACTTCTCCCGGATGCGAGTAGATTCTG
JMFN028J08+ CTTTTTCAACAATCACGGGAATTCTTTCAGGATACTTCTCCCGGATGCGAGTAGATTCTG
JMFN016L21+ CTTTTTCAACAATCACGGGAATTCTTTCAGGATACTTCTCCCGGATGCGAGTAGATTCTG
JMFN016J23+ CTTTTTCAACAATCACGGGAATTCTTTCAGGATACTTCTCCCGGATGCGAGTAGATTCTG
rJMSF012K14- CTTTTTCAACAATCACGGGAATTCTTTCAGGANACTTCNCCCGGANGCNAGNANATTCTG
                      ____________________________________________________________
consensus CTTTTTCAACAATCACGGGAATTCTTTCAGGATACTTCTCCCGGATGCGAGTAGATTCTG
 
. : . : . : . : . : . :
JMFS109A11- ACTGCCTCCTCTCCAAAGGATGATCAAACTTGAAGCTCTTAGCCATGGAAAGACTTGAAC
JMFN039L07+ ACTGCCTCCTCTCCAAAGGATGATCAAACTTGAAGCTCTTAGCCATGGAAAGACTTGAAC
JMFN010C20+ ACTGCCTCCTCTCCAAAGGATGATCAAACTTGAAGCTCTTAGCCATGGAAAGACTTGAAC
JMFN028J08+ ACTGCCTCCTCTCCAAAGGATGATCAAACTTGAAGCTCTTAGCCATGGAAAGACTTGAAC
JMFN016L21+ ACTGCCTCCTCTCCAAAGGATGATCAAACTTGAAGCTCTTAGCCATGGAAAGACTTGAAC
JMFN016J23+ ACTGCCTCCTCTCCAAAGGATGATCAAACTTGAAGCTCTTAGCCATGGAAAGACTTGAAC
rJMSF012K14- ACNGCCNCCTCNCCAAAGGANGATCAAACTTGAAGCTCTTANCCANGGAAAGACTTGAAC
JMSF012K14+ TAGCCATGGAAAGACTTGAAC
                      ____________________________________________________________
consensus ACTGCCTCCTCTCCAAAGGATGATCAAACTTGAAGCTCTTAGCCATGGAAAGACTTGAAC
 
. : . : . : . : . : . :
JMFS109A11- TTTGACCTCTCTCCAACAACAGAAAAACCTTCAAAC
JMFN039L07+ TTTGACCTCTCTCCAACAACAGAAAAACCTTCAAACTTGCGGAAGACGATAATTGATGAG
JMFN010C20+ TTTGACCTCTCTCCAACAACAGAAAAACCTTCAAACTTGCGGAAGACGATAATTGATGAG
JMFN028J08+ TTTGACCTCTCTCCAACAACAGAAAAACCTTCAAACTTGCGGAAGACGATAATTGATGAG
JMFN016L21+ TTTGACCTCTCTCCAACAACAGAAAAACCTTCAAACTTGCGGAAGACGATAATTGATGAG
JMFN016J23+ TTTGACCTCTCTCCAACAACAGAAAAACCTTCAAACTTGCGGAAGACGATAATTGATGAG
rJMSF012K14- TTTGACCTCTCNCCAACAACANAAAAACCTTCAAACTTGCGNAANACNATAATTGATGAG
JMSF012K14+ TTTGACCTCTCTCCAACAACAGAAAAACCTTCAAACTTGCGGAAGACGATAATTGATGAG
                      ____________________________________________________________
consensus TTTGACCTCTCTCCAACAACAGAAAAACCTTCAAACTTGCGGAAGACGATAATTGATGAG
 
. : . : . : . : . : . :
JMFN039L07+ AA
JMFN010C20+ AA
JMFN028J08+ AA
JMFN016L21+ AAGA
JMFN016J23+ AAGA
rJMSF012K14- AANAATAAGTTTNGGGTATTCCGNATTCCAAAAAGTTATGATTGANAAGGGGTTATAAGG
JMSF012K14+ AAGAATAAGTTTTGGGTATTCCGTATTCCAAAAAGTTATGATTGAGAAGGGGTTATAAGG
                      ____________________________________________________________
consensus AAGAATAAGTTTTGGGTATTCCGTATTCCAAAAAGTTATGATTGAGAAGGGGTTATAAGG
 
. : . : . : . : . : . :
rJMSF012K14- ATGANAAACGCTAAACTAGGTTCCTGAATGCTCACG
JMSF012K14+ ATGAGAAACGCTAAACTAGGTTCCTGAATGCTCACGAAATCAGGAGAGTTTGGTTCGGCC
                      ____________________________________________________________
consensus ATGAGAAACGCTAAACTAGGTTCCTGAATGCTCACGAAATCAGGAGAGTTTGGTTCGGCC