Previous Contig 005331:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN007C15Sequence487005331 (4)gb:AY085644_15707124e-30Arabidopsis thaliana clone 1650 mRNA, complete sequence.>gb:BT000017_1634295 Ara
JMFN028G21Sequence472005331 (4)gb:AY085644_15707124e-30Arabidopsis thaliana clone 1650 mRNA, complete sequence.>gb:BT000017_1634295 Ara
JMSF012K12Sequence497005331 (4)gb:AY085644_15707125e-30Arabidopsis thaliana clone 1650 mRNA, complete sequence.>gb:BT000017_1634295 Ara491005331 (4)gb:AY085644_15707124e-30Arabidopsis thaliana clone 1650 mRNA, complete sequence.>gb:BT000017_1634295 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN028G21+ AACCTCCAAAGATACAATTAATTTTATTTCAATGAATTGCAATATTGACAACA
JMFN007C15+ AACCTCCAAAGATACAATTAATTTTATTTCAATGAATTGCAATATTGACAACA
rJMSF012K12- TATTGACAACA
JMSF012K12+ TATTGACAACA
                      ____________________________________________________________
consensus AACCTCCAAAGATACAATTAATTTTATTTCAATGAATTGCAATATTGACAACA
 
. : . : . : . : . : . :
JMFN028G21+ GCTAGATCTCGTGCTCAACAT-GTATGATCACAGAAGTATAGTTACATACAGTACGAAAA
JMFN007C15+ GCTAGATCTCGTGCTCAACAT-GTATGATCACAGAAGTATAGTTACATACAGTACGAAAA
rJMSF012K12- GCTAGATCTCGTGCTCAACATGGTATGATCACAGAAGTATAGTTACATACAGTACGAAAA
JMSF012K12+ GCTAGATCTCGTGCTCAACAT-GTATGATCACAGAAGTATAGTTACATACAGTACGAAAA
                      ____________________________________________________________
consensus GCTAGATCTCGTGCTCAACAT-GTATGATCACAGAAGTATAGTTACATACAGTACGAAAA
 
. : . : . : . : . : . :
JMFN028G21+ TGAAGTAGCCCGTAGCTTACAGATAACTGATAAAAAGTAGCAGCACAAATCTAGTCTAGT
JMFN007C15+ TGAAGTAGCCCGTAGCTTACAGATAACTGATAAAAAGTAGCAGCACAAATCTAGTCTAGT
rJMSF012K12- TGAAGTAGCCCGTAGCTTACAGATAACTGATAAAAAGTAGCAGCACAAATCTAGTCTAGT
JMSF012K12+ TGAAGTAGCCCGTAGCTTACAGATAACTGATAAAAAGTAGCAGCACAAATCTAGTCTAGT
                      ____________________________________________________________
consensus TGAAGTAGCCCGTAGCTTACAGATAACTGATAAAAAGTAGCAGCACAAATCTAGTCTAGT
 
. : . : . : . : . : . :
JMFN028G21+ GAGAAATGAGAATATCACCGATCATGAATCAAGTATTAAACAGAGCTGGATTAGCCGTGG
JMFN007C15+ GAGAAATGAGAATATCACCGATCATGAATCAAGTATTAAACAGAGCTGGATTAGCCGTGG
rJMSF012K12- GAGAAATGAGAATATCACCGATCATGAATCAAGTATTAAACAGAGCTGGATTAGCCGTGG
JMSF012K12+ GAGAAATGAGAATATCACCGATCATGAATCAAGTATTAAACAGAGCTGGATTAGCCGTGG
                      ____________________________________________________________
consensus GAGAAATGAGAATATCACCGATCATGAATCAAGTATTAAACAGAGCTGGATTAGCCGTGG
 
. : . : . : . : . : . :
JMFN028G21+ CCGTGCTAACTTGAACTTCGAGCAGTTCTAGTCTACGCTCCAGTGTATCGAGCTTCTCGT
JMFN007C15+ CCGTGCTAACTTGAACTTCGAGCAGTTCTAGTCTACGCTCCAGTGTATCGAGCTTCTCGT
rJMSF012K12- CCGTGCTAACTTGAACTTCGAGCAGTTCTAGTCTACGCTCCAGTGTATCGAGCTTCTCGT
JMSF012K12+ CCGTGCTAACTTGAACTTCGAGCAGTTCTAGTCTACGCTCCAGTGTATCGAGCTTCTCGT
                      ____________________________________________________________
consensus CCGTGCTAACTTGAACTTCGAGCAGTTCTAGTCTACGCTCCAGTGTATCGAGCTTCTCGT
 
. : . : . : . : . : . :
JMFN028G21+ TCAACGACGCCAGTTTGCTCTTCGTCGTCACCTCGAATTGGACGAGGAAATCAAAGAGGC
JMFN007C15+ TCAACGACGCCAGTTTGCTCTTCGTCGTCACCTCGAATTGGACGAGGAAATCAAAGAGGC
rJMSF012K12- TCAACGACGCCAGTTTGCTCTTCGTCGTCACCTCGAATTGGACGAGGAAATCAAAGAGGC
JMSF012K12+ TCAACGACGCCAGTTTGCTCTTCGTCGTCACCTCGAATTGGACGAGGAAATCAAAGAGGC
                      ____________________________________________________________
consensus TCAACGACGCCAGTTTGCTCTTCGTCGTCACCTCGAATTGGACGAGGAAATCAAAGAGGC
 
. : . : . : . : . : . :
JMFN028G21+ GGCGGACATTAAGGGAGATGTTAGAGATGAATTCGCGGTTCTCCCAGTCTGCCTGCACCG
JMFN007C15+ GGCGGACATTAAGGGAGATGTTAGAGATGAATTCGCGGTTCTCCCAGTCTGCCTGCACCG
rJMSF012K12- GGCGGACATTAAGGGAGATGTTAGAGATGAATTCGCGGTTCTCCCAGTCTGCCTGCACCG
JMSF012K12+ GGCGGACATTAAGGGAGATGTTAGAGATGAATTCGCGGTTCTCCCAGTCTGCCTGCACCG
                      ____________________________________________________________
consensus GGCGGACATTAAGGGAGATGTTAGAGATGAATTCGCGGTTCTCCCAGTCTGCCTGCACCG
 
. : . : . : . : . : . :
JMFN028G21+ CTATTCCCACGTTTACGGCGTTCGTTATCCCGCCGGCTCTCGCCA-TTTTGCCGCTCCTC
JMFN007C15+ CTATTCCCACGTTTACGGCGTTCGTTATCCCGCCGGCTCTCGCCATTTTTGCCGCTCCTC
rJMSF012K12- CTATTCCCACGTTTACGGCGTTCGTTATCCCGCCGGCTCTCGCCATTTTTGCCGCTCCTC
JMSF012K12+ CTATTCCCACGTTTACGGCGTTCGTTATCCCGCCGGCTCTCGCCATTTTTGCCGCTCCTC
                      ____________________________________________________________
consensus CTATTCCCACGTTTACGGCGTTCGTTATCCCGCCGGCTCTCGCCATTTTTGCCGCTCCTC
 
. : . : . : . : . : . :
JMFN028G21+ T
JMFN007C15+ TCTCCCCTCCTTCAC
rJMSF012K12- TCTCCCCTCCTTCACGAGACAGCTTTTACTAGATTTTGGTAGGTTTTGCTTTTTTATTTC
JMSF012K12+ TCTCCCCTCCTTCACGAGACAGCTTTTACTAGATTTTGGTAGGTTTTGCTTTTTTATTTC
                      ____________________________________________________________
consensus TCTCCCCTCCTTCACGAGACAGCTTTTACTAGATTTTGGTAGGTTTTGCTTTTTTATTTC