Previous Contig 005330:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012J24Sequence359005330 (2)gb:AY830138_16293383e-06Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.773022501
JMSF037M15Sequence697005330 (2)gb:AB125881_15282238e-16Ipomoea batatas SRF2 mRNA for NBS-LRR protein, partial cds.711023781gb:AY169003_15864357e-47Arabidopsis thaliana hypothetical protein (F10A12.11) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037M15+ GAGTTCATCTCTTGA
                      ____________________________________________________________
consensus GAGTTCATCTCTTGA
 
. : . : . : . : . : . :
JMSF037M15+ TGCTGCTGTAAACACAACCAATAAGGCATCGGAGCGTTTGTTCCTGGTTAAACTCTTGGG
                      ____________________________________________________________
consensus TGCTGCTGTAAACACAACCAATAAGGCATCGGAGCGTTTGTTCCTGGTTAAACTCTTGGG
 
. : . : . : . : . : . :
JMSF037M15+ ATACACTAACCCATGCTCGCATGTCAAAATAAGAAGTAATTGACGGATGTTCATAAACTT
                      ____________________________________________________________
consensus ATACACTAACCCATGCTCGCATGTCAAAATAAGAAGTAATTGACGGATGTTCATAAACTT
 
. : . : . : . : . : . :
JMSF037M15+ TTTGTGCTAAAGTGGTCTTGCCTATTCCTCCCATGCCAACAATTGAAACAACTTGTCTCC
                      ____________________________________________________________
consensus TTTGTGCTAAAGTGGTCTTGCCTATTCCTCCCATGCCAACAATTGAAACAACTTGTCTCC
 
. : . : . : . : . : . :
JMSF037M15+ CCTTAGTTGATTGTTGTGTGAGCTTATCCAATATCGTGTTGAACGCCCATGGCATCCCAC
                      ____________________________________________________________
consensus CCTTAGTTGATTGTTGTGTGAGCTTATCCAATATCGTGTTGAACGCCCATGGCATCCCAC
 
. : . : . : . : . : . :
JMSF037M15+ CATTCTACTGTCCAACTTTGAAGCGGTTTTTGAAAATTTTCTCACAATAATGTTCTTGTG
                      ____________________________________________________________
consensus CATTCTACTGTCCAACTTTGAAGCGGTTTTTGAAAATTTTCTCACAATAATGTTCTTGTG
 
. : . : . : . : . : . :
JMSF037M15+ TGCTAGAACAGGCTGTGATAATCCTCCTCCGTTCTCAAGCAGTAGTCCTCTTCGTTGGAT
                      ____________________________________________________________
consensus TGCTAGAACAGGCTGTGATAATCCTCCTCCGTTCTCAAGCAGTAGTCCTCTTCGTTGGAT
 
. : . : . : . : . : . :
JMSF037M15+ CCGACCAAGGAGTGAAACATCAGTGATTCTTTCGTTTTGTGATGAAGCCGCCTTTGCAAT
                      ____________________________________________________________
consensus CCGACCAAGGAGTGAAACATCAGTGATTCTTTCGTTTTGTGATGAAGCCGCCTTTGCAAT
 
. : . : . : . : . : . :
JMSF037M15+ TAGCTGGTATTCAGTTTGAATCCTAATCAACTCATTCCTGTGGTAATCAGTCTGTTTTTC
                      ____________________________________________________________
consensus TAGCTGGTATTCAGTTTGAATCCTAATCAACTCATTCCTGTGGTAATCAGTCTGTTTTTC
 
. : . : . : . : . : . :
JMSF037M15+ TGCTTCAATGAAGATTTGATGAAGCCTGAGCAGGCAAGATGTTATATGAAGAAGACTATC
                      ____________________________________________________________
consensus TGCTTCAATGAAGATTTGATGAAGCCTGAGCAGGCAAGATGTTATATGAAGAAGACTATC
 
. : . : . : . : . : . :
JMSF037M15+ CTTTGCTAGATAAATTGTAGTCAACTCCATCTCAATCCTTTCTTCGGCTTTGAACCATAC
JMSF012J24+ TCAACTCCGTCTCAATCCTTTCTACGGCTTTGAACAATAC
                      ____________________________________________________________
consensus CTTTGCTAGATAAATTGTAGTCAACTCCGTCTCAATCCTTTCTTCGGCTTTGAACCATAC
 
. : . : . : . : . : . :
JMSF037M15+ ATCTCTGATCTCTGCCTCTAAATCTTTCATCGCCCCCGCATCATCATTGCC
JMSF012J24+ ATCTCTGATCTCTGCCTCTAAATCTTTCATCGCCCCCGCATTATCATTGCCCACGATCTC
                      ____________________________________________________________
consensus ATCTCTGATCTCTGCCTCTAAATCTTTCATCGCCCCCGCATTATCATTGCCCACGATCTC
 
. : . : . : . : . : . :
JMSF012J24+ TGACGATTCCTCAAGACTTTCTTGCAGGAAGAGAAGATTTTCATGGAGAGAAACCATCTC
                      ____________________________________________________________
consensus TGACGATTCCTCAAGACTTTCTTGCAGGAAGAGAAGATTTTCATGGAGAGAAACCATCTC
 
. : . : . : . : . : . :
JMSF012J24+ TTGTTTGTTATCAAGAGGCAAGCGTGGTTGTGATTGCAAGAAATGTTGAGAAAGTGTTTC
                      ____________________________________________________________
consensus TTGTTTGTTATCAAGAGGCAAGCGTGGTTGTGATTGCAAGAAATGTTGAGAAAGTGTTTC
 
. : . : . : . : . : . :
JMSF012J24+ CATAAGGGAAGTTACAGCAGCGTAAGCCATTTCCGTCTCTCTCTTTGTGGTAAGGTGATC
                      ____________________________________________________________
consensus CATAAGGGAAGTTACAGCAGCGTAAGCCATTTCCGTCTCTCTCTTTGTGGTAAGGTGATC