Previous Contig 005324:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012I16Sequence512005324 (2)744011697 (30)
JMSF027B13Sequence768005324 (2)753011697 (30)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027B13+ TCATCATCGNGCTCTCTATCTTCTGTCAACCACCATGTCCATACAGCCAGC
                      ____________________________________________________________
consensus TCATCATCGNGCTCTCTATCTTCTGTCAACCACCATGTCCATACAGCCAGC
 
. : . : . : . : . : . :
JMSF027B13+ CCCTTCTTTCTCTACNTACANTACACACCGATGTCTACATCGACATTTCAATTGGTTCGT
                      ____________________________________________________________
consensus CCCTTCTTTCTCTACNTACANTACACACCGATGTCTACATCGACATTTCAATTGGTTCGT
 
. : . : . : . : . : . :
JMSF027B13+ TCTAGAGTGGTAGAGTGTAGACAAGAACATAAACNTAAGCCCCGGTAGGGACAATGTGAG
                      ____________________________________________________________
consensus TCTAGAGTGGTAGAGTGTAGACAAGAACATAAACNTAAGCCCCGGTAGGGACAATGTGAG
 
. : . : . : . : . : . :
JMSF027B13+ AATTTCACCCAATGTGGTAGGTTGGTTATGAACGCTCAGCAGACCGCAGTACTAGTCCTT
                      ____________________________________________________________
consensus AATTTCACCCAATGTGGTAGGTTGGTTATGAACGCTCAGCAGACCGCAGTACTAGTCCTT
 
. : . : . : . : . : . :
JMSF027B13+ TCACTTAATGGGTCTCTGCCCTGCTGAGTCATGGGGCCCTGTAGATCAGGCGAGGGAGTT
JMSF012I16+ TCATGGGGCCCTGTAGATCAGGCGAGGGAGTT
                      ____________________________________________________________
consensus TCACTTAATGGGTCTCTGCCCTGCTGAGTCATGGGGCCCTGTAGATCAGGCGAGGGAGTT
 
. : . : . : . : . : . :
JMSF027B13+ TCACTTTCTGTAAGCAAGTAATTATATATCTACTACAAAAACCAGCTAATTTTGCATCAT
JMSF012I16+ TCACTTTCTGTAAGCAAGTAATTATATATCTACTACAAAAACCAGNTAATTTTGCATCAT
                      ____________________________________________________________
consensus TCACTTTCTGTAAGCAAGTAATTATATATCTACTACAAAAACCAGCTAATTTTGCATCAT
 
. : . : . : . : . : . :
JMSF027B13+ CCATGCATTGCACTCGGTCACATGCAGTAAATGATGATAAATTATGAACAATTAAAATCG
JMSF012I16+ CCATGCATTGCACTCGGTCACATGCAGTAAATGATGATAAATTATGAACAATTAAAATCG
                      ____________________________________________________________
consensus CCATGCATTGCACTCGGTCACATGCAGTAAATGATGATAAATTATGAACAATTAAAATCG
 
. : . : . : . : . : . :
JMSF027B13+ CAAATTAAAGAAAGCAGAAAGTAGGAAATGGGCAAGTGCTACATACATGGAGTGAAGAGA
JMSF012I16+ CAAATTAAAGAAAGCAGAAAGTAGGAAATGGGCAAGTGCTACATACATGGAGTGAAGAGA
                      ____________________________________________________________
consensus CAAATTAAAGAAAGCAGAAAGTAGGAAATGGGCAAGTGCTACATACATGGAGTGAAGAGA
 
. : . : . : . : . : . :
JMSF027B13+ ATCCGGCGGTGATGACAGAAGAGTAGAGAGCACAAAGAAGAAGATACACACAATATATAT
JMSF012I16+ ATCCGGCGGTGATGACAGAAGAGTAGAGAGCACAAAGAAGAAGATACACACAATATATAT
                      ____________________________________________________________
consensus ATCCGGCGGTGATGACAGAAGAGTAGAGAGCACAAAGAAGAAGATACACACAATATATAT
 
. : . : . : . : . : . :
JMSF027B13+ ACTAACAATTCTCCGATCACATTCATGCATCCTCAGCTCCGGCCACCGGACGGTGTACCT
JMSF012I16+ ACTAACAATTCTCCGATCACATTCATGCATCCTCAGCTCCGGCCACCGGACGGTGTACCT
                      ____________________________________________________________
consensus ACTAACAATTCTCCGATCACATTCATGCATCCTCAGCTCCGGCCACCGGACGGTGTACCT
 
. : . : . : . : . : . :
JMSF027B13+ CATCATCTGTGCTCTCTATCTTCTGTCAACTCATCACCACGCTGTCTCTTCACCCTGCTA
JMSF012I16+ CATCATCTGTGCTCTCTATCTTCTGTCAACTCATCACCACGCTGTCTCTTCACCCTGCTA
                      ____________________________________________________________
consensus CATCATCTGTGCTCTCTATCTTCTGTCAACTCATCACCACGCTGTCTCTTCACCCTGCTA
 
. : . : . : . : . : . :
JMSF027B13+ GAGAGATTGACAAATATATATATAGAAAGAATAGTGAATAAAGTTGATGAGTTTTTTCCT
JMSF012I16+ GAGAGATTGACAAATATATATATAGAAAGAATAGTGAATAAAGTTGATGAGTTTTTTCCT
                      ____________________________________________________________
consensus GAGAGATTGACAAATATATATATAGAAAGAATAGTGAATAAAGTTGATGAGTTTTTTCCT
 
. : . : . : . : . : . :
JMSF027B13+ GTATTAGCTATTTTTGCACTGTCTATATGTATGCTGCTAGAAGCTATGGATGGTTC
JMSF012I16+ GTATTAGCTATTTTTGCACNGTCTATATGTATGCTGCTAGAAGCTATGGATGGTTCGAGC
                      ____________________________________________________________
consensus GTATTAGCTATTTTTGCACTGTCTATATGTATGCTGCTAGAAGCTATGGATGGTTCGAGC