Previous Contig 005321:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN039F23Sequence546005321 (5)pir|T06654|T066543e-05hypothetical protein T6G15.70 - Arabidopsis thaliana>gb:ATCHRIV36_1545116 Arabid
JMSF012H23Sequence246005321 (5)pir|T06654|T066542e-05hypothetical protein T6G15.70 - Arabidopsis thaliana>gb:ATCHRIV36_1545116 Arabid443005321 (5)pir|T06654|T066542e-05hypothetical protein T6G15.70 - Arabidopsis thaliana>gb:ATCHRIV36_1545116 Arabid
JMSF033B08Sequence433005321 (5)pir|T06654|T066549e-05hypothetical protein T6G15.70 - Arabidopsis thaliana>gb:ATCHRIV36_1545116 Arabid389005321 (5)pir|T06654|T066549e-05hypothetical protein T6G15.70 - Arabidopsis thaliana>gb:ATCHRIV36_1545116 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN039F23+ CAATCAGAAACGACGTAAAATTCTCATACAA
                      ____________________________________________________________
consensus CAATCAGAAACGACGTAAAATTCTCATACAA
 
. : . : . : . : . : . :
JMFN039F23+ CTCAGTAAACACACGGTAATTTCACCTAGAATTCTAGAGAGTAATAGTTTATACTGATGA
                      ____________________________________________________________
consensus CTCAGTAAACACACGGTAATTTCACCTAGAATTCTAGAGAGTAATAGTTTATACTGATGA
 
. : . : . : . : . : . :
JMFN039F23+ AGTAAATGCAATTAAACCCTAATCAGAACTACTTCAACAAGAGACTGGCAACTGAAAAAC
JMSF033B08+ CTGAAAAAC
rJMSF012H23- CTGAAAAAC
                      ____________________________________________________________
consensus AGTAAATGCAATTAAACCCTAATCAGAACTACTTCAACAAGAGACTGGCAACTGAAAAAC
 
. : . : . : . : . : . :
JMFN039F23+ ACAATGAACATAAAATTTTATTTAAACTTTCAATTTCCGGTTAATTCTTCAGCAGAATCC
rJMSF033B08- ATTTCCGGTTAATTCTTCAGCAGAATCC
JMSF033B08+ ACAATGAACATAAAATTTTATTTAAACTTTCAATTTCCGGTTAATTCTTCAGCAGAATCC
rJMSF012H23- ACAATGAACATAAAATTTTATTTAAACTTTCAATTTCCGGTTAATTCTTCAGCAGAATCC
                      ____________________________________________________________
consensus ACAATGAACATAAAATTTTATTTAAACTTTCAATTTCCGGTTAATTCTTCAGCAGAATCC
 
. : . : . : . : . : . :
JMFN039F23+ ACTGAGTGGATATTCAGAAACACGACAGATAATAAAGAGTAGAAGGATTGATTTGGCAGG
rJMSF033B08- ACTGAGTGGATATTCAGAAACACGACAGATAATAAAGAGTAGAAGGATTGATTTGGCAGG
JMSF033B08+ ACTGAGTGGATATTCAGAAACACGACAGATAATAAAGAGTAGAAGGATTGATTTGGCAGG
rJMSF012H23- ACTGAGTGGATATTCAGAAACACGACAGATAATAAAGAGTAGAAGGATTGATTTGGCAGG
                      ____________________________________________________________
consensus ACTGAGTGGATATTCAGAAACACGACAGATAATAAAGAGTAGAAGGATTGATTTGGCAGG
 
. : . : . : . : . : . :
JMFN039F23+ GAGAGGAGAGGAGGGGGGACTAAATTCACTAAAACACCGTTTCAGTTGATGTCGGAATCG
rJMSF033B08- GAGAGGAGAGGAGGGGGGACTAAATTCACTAAAACACCGTTTCAGTTGATGTCGGAATCG
JMSF033B08+ GAGAGGAGAGGAGGGGGGACTAAATTCACTAAAACACCGTTTCAGTTGATGTCGGAATCG
rJMSF012H23- GAGAGGAGAGGAGGGGGGACTAAATTCACTAAAACACCGTTTCAGTTGATGTCGGAATCG
JMSF012H23+ GAATCG
                      ____________________________________________________________
consensus GAGAGGAGAGGAGGGGGGACTAAATTCACTAAAACACCGTTTCAGTTGATGTCGGAATCG
 
. : . : . : . : . : . :
JMFN039F23+ TCGAAATCGTCTTCAAAGGAGTTGAAGAAGTCGGCATCGGCGAGGCGGTGGTGCTCGGTA
rJMSF033B08- TCGAAATCGTCTTCAAAGGAGTTGAAGAAGTCGGCATCGGCGAGGCGGTGGTGCTCGGTA
JMSF033B08+ TCGAAATCGTCTTCAAAGGAGTTGAAGAAGTCGGCATCGGCGAGGCGGTGGTGCTCGGTA
rJMSF012H23- TCGAAATCGTCTTCAAAGGAGTTGAAGAAGTCGGCATCGGCGAGGCGGTGGTGCTCGGTA
JMSF012H23+ TCGAAATCGTCTTCAAAGGAGTTGAAGAAGTCGGCATCGGCGAGGCGGTGGTGCTCGGTA
                      ____________________________________________________________
consensus TCGAAATCGTCTTCAAAGGAGTTGAAGAAGTCGGCATCGGCGAGGCGGTGGTGCTCGGTA
 
. : . : . : . : . : . :
JMFN039F23+ GGGCCGCCGAGGGGACCCTCGCCAAAGATCTCGAGCGCTTCCACGTCGTCTACGTCCATC
rJMSF033B08- GGGCCGCCGAGGGGACTCTCGCCAAAGATCTCGAGCGCTTCCACGTCGTCTACGTCCATC
JMSF033B08+ GGGCCGCCGAGGGGACTCTCGCCAAAGATCTCGAGCGCTTCCACGTCGTCTACGTCCATC
rJMSF012H23- GGGCCGCCGAGGGGACCCTCGCCAAAGATCTCGAGCGCTTCCACGTCGTCTACGTCCATC
JMSF012H23+ GGGCCGCCGAGGGGACCCTCGCCAAAGATCTCGAGCGCTTCCACGTCGTCTACGTCCATC
                      ____________________________________________________________
consensus GGGCCGCCGAGGGGACCCTCGCCAAAGATCTCGAGCGCTTCCACGTCGTCTACGTCCATC
 
. : . : . : . : . : . :
JMFN039F23+ GCCATGGTGGATCCTTGCTCATCCAAATCCGCGAAGTAGTCTACCGCCATAGGCTTCATC
rJMSF033B08- GCCATGGTGGATCCTTGCTCATCCAAATCCGCGAAGTAGTCTACCGCCATAGGCTTCATC
JMSF033B08+ GCCATGGTGGATCCTTGCTCATCCAAATCCGCGAAGTAGTCTACCGCCATAGGCTTCATC
rJMSF012H23- GCCATGGTGGATCCTTGCTCATCCAAATCCGCGAAGTAGTCTACCGCCATAGGCTTCATC
JMSF012H23+ GCCATGGTGGATCCTTGCTCATCCAAATCCGCGAAGTAGTCTACCGCCATAGGCTTCATC
                      ____________________________________________________________
consensus GCCATGGTGGATCCTTGCTCATCCAAATCCGCGAAGTAGTCTACCGCCATAGGCTTCATC
 
. : . : . : . : . : . :
JMFN039F23+ TTTTCAGTTCTCAATTCTCTTCTCAGAAGCCTCTT
rJMSF033B08- TTTTCAGTTCTCAATTCTCTTCTCAGAAGCCTCTTGTTTCCTTCTTGCGTCGC
JMSF033B08+ TTTTCAGTTCTCAATTCTCTTCTCAGAAGCCTCTTGTTTCCTTCTTGCGTCGC
rJMSF012H23- TTTTCAGTTCTCAATTCTCTTCTCAGAAGCCTCTTGTTTCCTTCTTGCGTCGC
JMSF012H23+ TTTTCAGTTCTCAATTCTCTTCTCAGAAGCCTCTTGTTTCCTTCTTGCGTCGCGCTTCCC
                      ____________________________________________________________
consensus TTTTCAGTTCTCAATTCTCTTCTCAGAAGCCTCTTGTTTCCTTCTTGCGTCGCGCTTCCC