Previous Contig 005310:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF042F13Sequence643005310 (3)gb:ATAC013454_15435231e-41Arabidopsis thaliana chromosome III BAC F2O10 genomic sequence, complete sequenc622010213 (4)gb:ATAC013454_15435232e-15Arabidopsis thaliana chromosome III BAC F2O10 genomic sequence, complete sequenc
JMSF012F07Sequence303005310 (3)779010213 (4)gb:ATAC013454_15435233e-47Arabidopsis thaliana chromosome III BAC F2O10 genomic sequence, complete sequenc
JMSF052B14Sequence690005310 (3)gb:ATAC013454_15435232e-24Arabidopsis thaliana chromosome III BAC F2O10 genomic sequence, complete sequenc773010213 (4)gb:ATAC013454_15435231e-40Arabidopsis thaliana chromosome III BAC F2O10 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF042F13+ G
                      ____________________________________________________________
consensus G
 
. : . : . : . : . : . :
JMFF042F13+ CCCAGTCAAATTANGAACAATAGCTCCTGGACCACCAACCCATTCTAAGCACAGCGATAG
                      ____________________________________________________________
consensus CCCAGTCAAATTANGAACAATAGCTCCTGGACCACCAACCCATTCTAAGCACAGCGATAG
 
. : . : . : . : . : . :
JMFF042F13+ GAAATTATATATGACCCAGGCTTCATATATTTCTCGCAAGGAATTGAAATATATTGCACT
JMSF052B14+ TTCTCGCAAGGAATTGAAATATATTGCACT
                      ____________________________________________________________
consensus GAAATTATATATGACCCAGGCTTCATATATTTCTCGCAAGGAATTGAAATATATTGCACT
 
. : . : . : . : . : . :
JMFF042F13+ TTTGTTCATTACAAGAGATAAAAAAGAGGCCAGCGCATAGACAGGAACCATAAATACGAT
JMSF052B14+ TTTGTTCATTACAAGAGATAAAAAAGAGGCCAGCGCATAGACAGGAACCATAAATACGAT
                      ____________________________________________________________
consensus TTTGTTCATTACAAGAGATAAAAAAGAGGCCAGCGCATAGACAGGAACCATAAATACGAT
 
. : . : . : . : . : . :
JMFF042F13+ GCGCACAATGTATCTCTGGTAGGTAGGTTCCGTGTAGTTCAAGAGGTGCAGATATATGTG
JMSF052B14+ GCGCACAATGTATCTCTGGTAGGTAGGTTCCGTGTAGTTCAAGAGGTGCAGATATATGTG
                      ____________________________________________________________
consensus GCGCACAATGTATCTCTGGTAGGTAGGTTCCGTGTAGTTCAAGAGGTGCAGATATATGTG
 
. : . : . : . : . : . :
JMFF042F13+ GAAGATTGCTAACCCAATGGCACCAGCCGTGCAAGGCAATGCAACAAGTATGTAGTATAT
JMSF052B14+ GAAGATTGCAAACCCAATGGCACCAGCCGTGCAAGGCAATGCAACAAGTATGTAGTATAT
                      ____________________________________________________________
consensus GAAGATTGCTAACCCAATGGCACCAGCCGTGCAAGGCAATGCAACAAGTATGTAGTATAT
 
. : . : . : . : . : . :
JMFF042F13+ AGGCCCCATTTCTTTTAGAAGGCTATCAATCAACTAAGATATCATACCTGTCTACACAAA
JMSF052B14+ AGGCCCCATTTCTTTTAGAAGGCTACCAATCAACTAAGATATCATACCTGTCTACACAAA
                      ____________________________________________________________
consensus AGGCCCCATTTCTTTTAGAAGGCTATCAATCAACTAAGATATCATACCTGTCTACACAAA
 
. : . : . : . : . : . :
JMFF042F13+ ACCTTCAGAGAGTGCCAGAAACTTGTAACATTCACTGCTTTGGCCTTTTCACTTAGCTGA
JMSF052B14+ ACCTTCAGAGAGTGCCAGAAACTTGTAACATTCACTGCTTTGGCCTTTTCACTTAGCTGA
                      ____________________________________________________________
consensus ACCTTCAGAGAGTGCCAGAAACTTGTAACATTCACTGCTTTGGCCTTTTCACTTAGCTGA
 
. : . : . : . : . : . :
JMFF042F13+ AAGGGCTCCTAAAGCCACCACAGGAAAAACCCTAACCCCAAAAATGTTTAACTTTGATCA
JMSF052B14+ AAGGGCTCCTAAAGCCACCACAGGAAAAACCCTAACCCCAAAAATGTTTAACTTTGATCA
JMSF012F07+ TCA
                      ____________________________________________________________
consensus AAGGGCTCCTAAAGCCACCACAGGAAAAACCCTAACCCCAAAAATGTTTAACTTTGATCA
 
. : . : . : . : . : . :
JMFF042F13+ ATGAAATCGACGGAAGAAATCAAGAACGCGATGGGTTCGAAAGATCTGGGGTTCTTCTTC
JMSF052B14+ ATGAAATCGACGGAAGAAATCAAGAACGCGATGGGTTCGAAAGATCTGGGGTTCTTCTTC
JMSF012F07+ ATGAAATCGACGGAAGAAATCAAGAACGCGATGGGTTCGAAAGATCTGGGGTTCTTCTTC
                      ____________________________________________________________
consensus ATGAAATCGACGGAAGAAATCAAGAACGCGATGGGTTCGAAAGATCTGGGGTTCTTCTTC
 
. : . : . : . : . : . :
JMFF042F13+ TGCGGCTGCTTTCGAAGGAGAAAATATACTCCGTAGAAAGAAAACCCGTTGGCGTTGGGA
JMSF052B14+ TGCGGCTGCTTTCGAAGGAGAAAATATACTCCGTAGAAAGAAAACCCGTTGGCGTTGGGA
JMSF012F07+ TGCGGCTGCTTTCGAAGGAGAAAATATACTCCGTAGAAAGAAAACCCGTTGGCGTTGGGA
                      ____________________________________________________________
consensus TGCGGCTGCTTTCGAAGGAGAAAATATACTCCGTAGAAAGAAAACCCGTTGGCGTTGGGA
 
. : . : . : . : . : . :
JMFF042F13+ AAGTTTGGGGGGGAAATAAAGGCTTCAACCTCAAAGGGC
JMSF052B14+ AAGTTTGGGGGGGAAATAAAGGCTTCAACCTCAAAGGGCAAAGGCTCAAAAGCACAGCCG
JMSF012F07+ AAGTTTGGGGGGGAAATAAAGGCTTCAACCTCAAAGGGCAAAGGCTCAAAAGCACAGCCG
                      ____________________________________________________________
consensus AAGTTTGGGGGGGAAATAAAGGCTTCAACCTCAAAGGGCAAAGGCTCAAAAGCACAGCCG
 
. : . : . : . : . : . :
JMSF052B14+ CGTAGGCTTATAACCAACAAAAAATTAGATTTGATTAGGGTTAAGAAATTGGGTGAATCG
JMSF012F07+ CGTAGGCTTATAACCAACAAAAAATTAGATTTGATTAGGGTTAAGAAATTGGGTGAATCG
                      ____________________________________________________________
consensus CGTAGGCTTATAACCAACAAAAAATTAGATTTGATTAGGGTTAAGAAATTGGGTGAATCG
 
. : . : . : . : . : . :
JMSF052B14+ GTGGTGGTTGTGGCGGTGATGATGGTGGTGCAACACTGGCGATGATAGCGGCTCAAC
JMSF012F07+ GTGGTGGTTGTGGCGGTGATGATGGTGGTGCAACACTGGCGATGATAGCGGCTCAACCCC
                      ____________________________________________________________
consensus GTGGTGGTTGTGGCGGTGATGATGGTGGTGCAACACTGGCGATGATAGCGGCTCAACCCC