Previous Contig 005304:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN015L05Sequence610005304 (9)gb:AY087717_15727452e-52Arabidopsis thaliana clone 37901 mRNA, complete sequence.
JMFS059G03Sequence622005304 (9)gb:AY087717_15727451e-54Arabidopsis thaliana clone 37901 mRNA, complete sequence.
JMSF003A09Sequence214005304 (9)737005304 (9)gb:AY087717_15727453e-81Arabidopsis thaliana clone 37901 mRNA, complete sequence.
JMSF012D23Sequence230005304 (9)468005304 (9)gb:AY087717_15727457e-24Arabidopsis thaliana clone 37901 mRNA, complete sequence.
JMSF031E09Sequence657005304 (9)gb:AY087717_15727452e-59Arabidopsis thaliana clone 37901 mRNA, complete sequence.568005304 (9)gb:AY042832_15608976e-23Arabidopsis thaliana ATP-dependent Clp protease-like protein (MFC19.5) mRNA, com
JMSF039H08Sequence691005304 (9)gb:AY087717_15727456e-62Arabidopsis thaliana clone 37901 mRNA, complete sequence.248023851gb:AY087717_15727453e-10Arabidopsis thaliana clone 37901 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF031E09- TATGAGTAGCTCCGCATGACATATTGAGCTATCATACA
                      ____________________________________________________________
consensus TATGAGTAGCTCCGCATGACATATTGAGCTATCATACA
 
. : . : . : . : . : . :
rJMSF031E09- TTGAATATCCCCTCTGCTTGAGGAAAATAAAAAAGAAAGAAAGAAAGAAAGAAAAACCTA
                      ____________________________________________________________
consensus TTGAATATCCCCTCTGCTTGAGGAAAATAAAAAAGAAAGAAAGAAAGAAAGAAAAACCTA
 
. : . : . : . : . : . :
rJMSF031E09- AAAAAAAAAAACCAGCATACNTTTCTTTTGGACAAGTAGTTCCATTCCATACNCAATCTT
rJMSF003A09- CAATCTT
                      ____________________________________________________________
consensus AAAAAAAAAAACCAGCATACNTTTCTTTTGGACAAGTAGTTCCATTCCATACNCAATCTT
 
. : . : . : . : . : . :
rJMSF031E09- TCANGTTTCAACCATAACNCTAAATCNCAAANGGGCTCNCCNGNNGNAATCAACCTCAAC
rJMSF012D23- AATCAACCTCANC
rJMSF003A09- TCA-GTTTCAACCATAACACTAAATCTCAAATGTGCTCTCCTGCTGCAATCAACCTCAAC
                      ____________________________________________________________
consensus TCANGTTTCAACCATAACACTAAATCTCAAATGTGCTCTCCTGCTGCAATCAACCTCAAC
 
. : . : . : . : . : . :
rJMSF031E09- TTCAATCTACAAAGCTGATGACTCTGCAAANGCATCANANGCCCCCNCCAANAANANAGA
rJMSF012D23- TTCAATCTACAANGCNGANGACTCNGCAAAGGCATCANANGCCCCCTCCANNAANAGAGA
rJMSF003A09- TTCAATCTACAAAGCTGATGACTATGCAAATGCATCATATGCCCCCTCCAAGAAGAGAGA
                      ____________________________________________________________
consensus TTCAATCTACAAAGCTGATGACTCTGCAAATGCATCATATGCCCCCTCCAAGAAGAGAGA
 
. : . : . : . : . : . :
rJMSF031E09- TTCAAGAGGCCNGCAAGNGCCATACCAGCTAATACAAT---TCATCAGGGATCNCNGGAT
rJMSF012D23- TTCAAGAGGCCNGCANGNGCCATACCAGCTAANACAATTCATCATCAGGGATCTCNGGAT
rJMSF003A09- TTCAAGAGGCCTGCAAGTGCCATACCAGCTAATACAATTCATCATCAGGGATCTCTGGAT
                      ____________________________________________________________
consensus TTCAAGAGGCCTGCAAGTGCCATACCAGCTAATACAATTCATCATCAGGGATCTCTGGAT
 
. : . : . : . : . : . :
rJMSF031E09- TAANAAATTTCTTTGGATCTTTAGGGACTTCCNCATAGCTAAGNGNAGCATTAACCCGAT
rJMSF012D23- TAANAAATTTCTTNGGATCTTTAGGGACTTCCNCATAGCTAAGGGTANCATTAACCCGAT
rJMSF003A09- TAAGAAATTTCTTTGGATCTTTAGTGACTTCCTCATAGCTAAGTGTAGCATTAACCCGAT
                      ____________________________________________________________
consensus TAAGAAATTTCTTTGGATCTTTAGGGACTTCCTCATAGCTAAGTGTAGCATTAACCCGAT
 
. : . : . : . : . : . :
rJMSF031E09- CAGGAACNGGTTCAAGNGCAATAANGCTTTCTTTGNCAATAACTCCNTCAATTATGCCAT
rJMSF012D23- CAGGAACNGGTTCANGNGCAATAANGNTTTCTTNGNCAATAACTCCNTCANTTANGCCAN
rJMSF003A09- CAGGAACTGGTTCAAGTGCAATAATGCTTTCTTTGTCAATAACTCCATCAATTATGCCAT
                      ____________________________________________________________
consensus CAGGAACTGGTTCAAGTGCAATAATGCTTTCTTTGTCAATAACTCCATCAATTATGCCAT
 
. : . : . : . : . : . :
rJMSF031E09- ATTCCNCNGNTTCAACGGGGGACATATAACGATCCCTATCAATATCTTTCNCAACTTGCT
rJMSF012D23- ATNCCACNGNTTCANCGGGGGACATANAACGATCCCTATNAATATCTTTCTCANCTTGCT
rJMSF003A09- ATTCCACTGCTTCAACGGGGGACATATAACGATCCCTATCAATATCTTTCTCAACTTGCT
                      ____________________________________________________________
consensus ATTCCACTGCTTCAACGGGGGACATATAACGATCCCTATCAATATCTTTCTCAACTTGCT
 
. : . : . : . : . : . :
rJMSF031E09- CAAATGAGCGGCCAGTAAAATTGGANATTATTCTAANAACATTCNCTTTGT
rJMSF012D23- CAAANGANCGGCCAGNAAAATNGGATATTATTCTAANAACNTTCNCTTTGTNGNGCANGA
rJMSF003A09- CAAATGAGCGGCCAGTAAAATTGGATATTATTCTAATAACATTCTCTTTGTTGTGCATGA
JMSF031E09+ GTTGTGCATGA
JMSF039H08+ ATTGGATATTATTCTAATAACATTCTCTTTGTTGTGCATGA
                      ____________________________________________________________
consensus CAAATGAGCGGCCAGTAAAATTGGATATTATTCTAATAACATTCTCTTTGTTGTGCATGA
 
. : . : . : . : . : . :
rJMSF012D23- TTTCTCGGGNTNGAATCTCAACANCAATTACTNGCCCACTTGCACCTCCA
rJMSF003A09- TTTCTCGGGCTTGAATCTCAACATCAATTACTTGCCCACTTGCACCTCCAAGTGGTTGAT
JMFS059G03+ TCTCAACATCAATTACTTGCCCACTTGCACCTCCAAGTGGTTGAT
JMSF031E09+ TTTCTCGGGCTTGAATCTCAACATCAATTACTTGCCCACTTGCACCTCCAAGTGGTTGAT
JMFN015L05+ TTACTTGCCCACTTGCACCTCCAAGTGGTTGAT
JMSF039H08+ TTTCTCGGGCTTGAATCTCAACATCAATTACTTGCCCACTTGCACCTCCAAGTGGTTGAT
                      ____________________________________________________________
consensus TTTCTCGGGCTTGAATCTCAACATCAATTACTTGCCCACTTGCACCTCCAAGTGGTTGAT
 
. : . : . : . : . : . :
rJMSF003A09- GCGTCATAATTCGAGTATTAGGCATTGCCAAACGCTTCCCTTTAGTGCCACCACCAAGGA
JMFS059G03+ GCGTCATAATTCGAGTATTAGGCATTGCCAAACGCTTCCCTTTAGTGCCACCACCAAGGA
JMSF031E09+ GCGTCATAATTCGAGTATTAGGCATTGCCAAACGCTTCCCTTTAGTGCCACCACCAAGGA
JMFN015L05+ GCGTCATAATTCGAGTATTAGGCATTGCCAAACGCTTCCCTTTAGTGCCACCACCAAGGA
JMSF039H08+ GCGTCATAATTCGAGTATTAGGCATTGCCAAACGCTTCCCTTTAGTGCCACCACCAAGGA
                      ____________________________________________________________
consensus GCGTCATAATTCGAGTATTAGGCATTGCCAAACGCTTCCCTTTAGTGCCACCACCAAGGA
 
. : . : . : . : . : . :
rJMSF003A09- TTATAGAAGCTGTTGAAGCTGAAATGCCTAGGGCAATTGTTGATACATCAGCTCTTAAAA
JMFS059G03+ TTATAGAAGCTGTTGAAGCTGAAATGCCTAGGGCAATTGTTGATACATCAGCTCTTAAAA
JMSF031E09+ TTATAGAAGCTGTTGAAGCTGAAATGCCTAGGGCAATTGTTGATACATCAGCTCTTAAAA
JMFN015L05+ TTATAGAAGCTGTTGAAGCTGAAATGCCTAGGGCAATTGTTGATACATCAGCTCTTAAAA
JMSF039H08+ TTATAGAAGCTGTTGAAGCTGAAATGCCTAGGGCAATTGTTGATACATCAGCTCTTAAAA
                      ____________________________________________________________
consensus TTATAGAAGCTGTTGAAGCTGAAATGCCTAGGGCAATTGTTGATACATCAGCTCTTAAAA
 
. : . : . : . : . : . :
rJMSF003A09- GCTGGATAACGTCAAAAATAGCCATGCTTGCACTTAGGGAGCCACCAGAACAATTGATGA
JMFS059G03+ GCTGGATAACGTCAAAAATAGCCATGCTTGCACTTAGGGAGCCACCAGAACAATTGATGA
JMSF031E09+ GCTGGATAACGTCAAAAATAGCCATGCTTGCACTTAGGGAGCCACCAGAACAATTGATGA
JMFN015L05+ GCTGGATAACGTCAAAAATAGCCATGCTTGCACTTAGGGAGCCACCAGAACAATTGATGA
JMSF039H08+ GCTGGATAACGTCAAAAATAGCCATGCTTGCACTTAGGGAGCCACCAGAACAATTGATGA
                      ____________________________________________________________
consensus GCTGGATAACGTCAAAAATAGCCATGCTTGCACTTAGGGAGCCACCAGAACAATTGATGA
 
. : . : . : . : . : . :
rJMSF003A09- ATAGCCTAATGTCTCTAGTGGGGTCCTGAGCATCCNACAGCAGCAACTGGCTGTTAATGG
JMFS059G03+ ATAGCCTAATGTCTCTAGTGGGGTCCTGAGCATCCAACAGCAGCAACTGGCTGTTAATGG
JMSF031E09+ ATAGCCTAATGTCTCTAGTGGGGTCCTGAGCATCCAACAGCAGCAACTGGCTGTTAATGG
JMFN015L05+ ATAGCCTAATGTCTCTAGTGGGGTCCTGAGCATCCAACAGCAGCAACTGGCTGTTAATGG
JMSF039H08+ ATAGCCTAATGTCTCTAGTGGGGTCCTGAGCATCCAACAGCAGCAACTGGCTGTTAATGG
                      ____________________________________________________________
consensus ATAGCCTAATGTCTCTAGTGGGGTCCTGAGCATCCAACAGCAGCAACTGGCTGTTAATGG
 
. : . : . : . : . : . :
rJMSF003A09- CGTCGGCAACG
JMFS059G03+ CGTCGGCAACGAAGTCGTCGATCTCGTTCCCCAGGAAAACGATTCTCTCCCTGAACAACA
JMSF031E09+ CGTCGGCAACGAAGTCGTCGATCTCGTTCCCCAGGAAAACGATTCTCTCCCTGAACAACA
JMFN015L05+ CGTCGGCAACGAAGTCGTCGATCTCGTTCCCCAGGAAAACGATTCTCTCCCTGAACAACA
JMSF039H08+ CGTCGGCAACGAAGTCGTCGATCTCGTTCCCCAGGAAAACGATTCTCTCCCTGAACAACA
                      ____________________________________________________________
consensus CGTCGGCAACGAAGTCGTCGATCTCGTTCCCCAGGAAAACGATTCTCTCCCTGAACAACA
 
. : . : . : . : . : . :
JMFS059G03+ GCCCCATGACGTCGGCCTCGGCTCCGCGCATAGCCGTGGCCTGCGTTTGCGGGGCCGAGG
JMSF031E09+ GCCCCATGACGTCGGCCTCGGCTCCGCGCATAGCCGTGGCCTGCGTTTGCGGGGCCGAGG
JMFN015L05+ GCCCCATGACGTCGGCCTCGGCTCCGCGCATAGCCGTGGCCTGCGTTTGCGGGGCCGAGG
JMSF039H08+ GCCCCATGACGTCGGCCTCGGCTCCGCGCATAGCCGTGGCCTGCGTTTGCGGGGCCGAGG
                      ____________________________________________________________
consensus GCCCCATGACGTCGGCCTCGGCTCCGCGCATAGCCGTGGCCTGCGTTTGCGGGGCCGAGG
 
. : . : . : . : . : . :
JMFS059G03+ CGAGATGGAGGGAGAGCCTATCGCTGTTGCTGAGAAATTGGGATTCGGAGAGGGGTTTCG
JMSF031E09+ CGAGATGGAGGGAGAGCCTATCGCTGTTGCTGAGAAATTGGGATTCGGAGAGGGGTTTCG
JMFN015L05+ CGAGATGGAGGGAGAGCCTATCGCTGTTGCTGAGAAATTGGGATTCGGAGAGGGGTTTCG
JMSF039H08+ CGAGATGGAGGGAGAGCCTATCGCTGTTGCTGAGAAATTGGGATTCGGAGAGGGGTTTCG
JMSF003A09+ CCTATCGCTGTTGCTGAGAAATTGGGATTCGGAGAGGGGTTTCG
JMSF012D23+ GGAGAGCCTATCGCTGTTGCTGAGAAATTGGGATTCGGAGAGGGGTTTCG
                      ____________________________________________________________
consensus CGAGATGGAGGGAGAGCCTATCGCTGTTGCTGAGAAATTGGGATTCGGAGAGGGGTTTCG
 
. : . : . : . : . : . :
JMFS059G03+ GGGTGGTGGGGAGGTGAGAATCGAGAATGCATTTGATAGAGGGCGGAGTGAACTTGAGAG
JMSF031E09+ GGGTGGTGGGGAGGTGAGAATCGAGAATGCATTTGATAGAGGGCGGAGTGAACTTGAGAG
JMFN015L05+ GGGTGGTGGGGAGGTGAGAATCGAGAATGCATTTGATAGAGGGCGGAGTGAACTTGAGAG
JMSF039H08+ GGGTGGTGGGGAGGTGAGAATCGAGAATGCATTTGATAGAGGGCGGAGTGAACTTGAGAG
JMSF003A09+ GGGTGGTGGGGAGGTGAGAATCGAGAATGCATTTGATAGAGGGCGGAGTGAACTTGAGAG
JMSF012D23+ GGGTGGTGGGGAGGTGAGAATCGAGAATGCATTTGATAGAGGGCGGAGTGAACTTGAGAG
                      ____________________________________________________________
consensus GGGTGGTGGGGAGGTGAGAATCGAGAATGCATTTGATAGAGGGCGGAGTGAACTTGAGAG
 
. : . : . : . : . : . :
JMFS059G03+ ACGGGTGGCGGAGCAGGCCGTGCCGGCGGAGGCGGAGATGAGTAGAGAGAGATGCGCGGT
JMSF031E09+ ACGGGTGGCGGAGCAGGCCGTGCCGGCGGAGGCGGAGATGAGTAGAGAGAGATGCGCGGT
JMFN015L05+ ACGGGTGGCGGAGCAGGCCGTGCCGGCGGAGGCGGAGATGAGTAGAGAGAGATGCGCGGT
JMSF039H08+ ACGGGTGGCGGAGCAGGCCGTGCCGGCGGAGGCGGAGATGAGTAGAGAGAGATGCGCGGT
JMSF003A09+ ACGGGTGGCGGAGCAGGCCGTGCCGGCGGAGGCGGAGATGAGTAGAGAGAGATGCGCGGT
JMSF012D23+ ACGGGTGGCGGAGCAGGCCGTGCCGGCGGAGGCGGAGATGAGTAGAGAGAGATGCGCGGT
                      ____________________________________________________________
consensus ACGGGTGGCGGAGCAGGCCGTGCCGGCGGAGGCGGAGATGAGTAGAGAGAGATGCGCGGT
 
. : . : . : . : . : . :
JMFS059G03+ GAGGAGAGAGAGGCGTTGAGAGTAGAGCGAGAGAGTC
JMSF031E09+ GAGGAGAGAGAGGCGTTGAGAGTAGAGCGAGAGAGTCCATTGTCC
JMFN015L05+ GAGGAGAGAGAGGCGTTGAGAGTAGAGCGAGAGAGTC
JMSF039H08+ GAGGAGAGAGAGGCGTTGAGAGTAGAGCGAGAGAGTCCATTGTCC
JMSF003A09+ GAGGAGAGAGAGGCGTTGAGAGTAGAGCGAGAGAGTCCATTGTCC
JMSF012D23+ GAGGAGAGAGAGGCGTTGAGAGTAGAGCGAGAGAGTCCATTGTCCGTTCAGTGAAGCCAA
                      ____________________________________________________________
consensus GAGGAGAGAGAGGCGTTGAGAGTAGAGCGAGAGAGTCCATTGTCCGTTCAGTGAAGCCAA