Previous Contig 005301:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS003E02Sequence537005301 (3)sp|P42762|ERD1_ARATH3e-40ERD1 protein, chloroplast precursor.>pir|JN0901|JN0901 endopeptidase Clp ATP-bin
JMSF012D06Sequence438005301 (3)gb:AP004030_18366122e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11758005301 (3)sp|P42762|ERD1_ARATH1e-24ERD1 protein, chloroplast precursor.>pir|JN0901|JN0901 endopeptidase Clp ATP-bin

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF012D06- AATTT
                      ____________________________________________________________
consensus AATTT
 
. : . : . : . : . : . :
rJMSF012D06- CCCTTGCAGGGATAGAGTTTGTGAAGCCATGGAAGTTTTAACAATGAAACTTGAATAATT
                      ____________________________________________________________
consensus CCCTTGCAGGGATAGAGTTTGTGAAGCCATGGAAGTTTTAACAATGAAACTTGAATAATT
 
. : . : . : . : . : . :
rJMSF012D06- AAATGCAAAAATTTAGCCCTCCCACCCCCTGAAACCCTGCATTAATGGGGCTAATGTCTG
                      ____________________________________________________________
consensus AAATGCAAAAATTTAGCCCTCCCACCCCCTGAAACCCTGCATTAATGGGGCTAATGTCTG
 
. : . : . : . : . : . :
JMFS003E02+ TCAGATGCTGGAGATACTGAATCTGATGCTGCAGGAGGTG
rJMSF012D06- TCTGTTTTCCATTATATATTTCAGATGCTGGAGATACTGAATCTGATGCTGCAGGAGGTG
                      ____________________________________________________________
consensus TCTGTTTTCCATTATATATTTCAGATGCTGGAGATACTGAATCTGATGCTGCAGGAGGTG
 
. : . : . : . : . : . :
JMFS003E02+ AAAGGCAGGCTTGTTTCCATGGGAATAGGGTTGGAAGTAACAGGTGCAACTATGGAGCTG
rJMSF012D06- AAAGGCAGGCTTGTTTCCATGGGAATAGGGTTGGAAGTAACAGGTGCAACTATGGAGCTG
                      ____________________________________________________________
consensus AAAGGCAGGCTTGTTTCCATGGGAATAGGGTTGGAAGTAACAGGTGCAACTATGGAGCTG
 
. : . : . : . : . : . :
JMFS003E02+ ATATGTGAACAAGGATTTGACAGAAACTACGGCGCCCGACCTCTTAGGAGGGCGCTAACC
rJMSF012D06- ATATGTGAACAAGGATTTGACAGAAACTACGGCGCCCGACCTCTTAGGAGGGCGCTAACC
                      ____________________________________________________________
consensus ATATGTGAACAAGGATTTGACAGAAACTACGGCGCCCGACCTCTTAGGAGGGCGCTAACC
 
. : . : . : . : . : . :
JMFS003E02+ AGCATAATTGAAGACCTCTTGAGTGAGTTTATACTTTCTGGAGATTACAACCCTGGTGAT
rJMSF012D06- AGCATAATTGAAGACCTCTTGAGTGAGTTTATACTTTCTGGAGATTACAACCCTGGTGAT
                      ____________________________________________________________
consensus AGCATAATTGAAGACCTCTTGAGTGAGTTTATACTTTCTGGAGATTACAACCCTGGTGAT
 
. : . : . : . : . : . :
JMFS003E02+ GTTGCTGTAATTCATTTAGATGATTCCGGGAATCCAATTGTCTCCAACCGATCAAGCCTC
rJMSF012D06- GTTGCTGTAATTCATTTAGATGATTCCGGGAATCCAATTGTCTCCAACCGATCAAGCCTC
                      ____________________________________________________________
consensus GTTGCTGTAATTCATTTAGATGATTCCGGGAATCCAATTGTCTCCAACCGATCAAGCCTC
 
. : . : . : . : . : . :
JMFS003E02+ ACCATGTCT
rJMSF012D06- ACCATGTCTTAATTTGCGTTACATTCCATAGGATCACCTTTGATGATTAGAAGAGCAATT
JMSF012D06+ ATGATTAGAAGAGCAATT
                      ____________________________________________________________
consensus ACCATGTCTTAATTTGCGTTACATTCCATAGGATCACCTTTGATGATTAGAAGAGCAATT
 
. : . : . : . : . : . :
rJMSF012D06- AATTGATCAAACTCTCCTTTGTCACCCATTAGTGTCTCACATGGATCTTAGCAATACACT
JMSF012D06+ AATTGATCAAACTCTCCTTTGTCACCCATTAGTGTCTCACATGGATCTTAGCAATACACT
                      ____________________________________________________________
consensus AATTGATCAAACTCTCCTTTGTCACCCATTAGTGTCTCACATGGATCTTAGCAATACACT
 
. : . : . : . : . : . :
rJMSF012D06- AGACAAAACAGCTTCTCATCACATGCTGGTCAGATATATAGCATTATAGCCTATTCCTGT
JMSF012D06+ AGACAAAACAGCTTCTCATCACATGCTGGTCAGATATATAGCATTATAGCCTATTCCTGT
                      ____________________________________________________________
consensus AGACAAAACAGCTTCTCATCACATGCTGGTCAGATATATAGCATTATAGCCTATTCCTGT
 
. : . : . : . : . : . :
rJMSF012D06- TCCATTGCTGTAGGTCCATCATCCTTCTGTACAGCAACACTATTTCCTTGCTCATTACTT
JMSF012D06+ TCCATTGCTGTAGGTCCATCATCCTTCTGTACAGCAACACTATTTCCTTGCTCATTACTT
                      ____________________________________________________________
consensus TCCATTGCTGTAGGTCCATCATCCTTCTGTACAGCAACACTATTTCCTTGCTCATTACTT
 
. : . : . : . : . : . :
rJMSF012D06- GCTTCATTCTCACCATCAGTAACCATTTTGTCTTCTTTAGCATCATCTTTCTTGGAACTG
JMSF012D06+ GCTTCATTCTCACCATCAGTAACCATTTTGTCTTCTTTAGCATCATCTTTCTTGGAACTG
                      ____________________________________________________________
consensus GCTTCATTCTCACCATCAGTAACCATTTTGTCTTCTTTAGCATCATCTTTCTTGGAACTG
 
. : . : . : . : . : . :
rJMSF012D06- GCATCGCCNTCACTGATAATCANATCTGCCGGA
JMSF012D06+ GCATCGCCATCACTGATAATCAGATCTGCCGGAAGTTGGCCAGACTTTAAAGCATTTTCT
                      ____________________________________________________________
consensus GCATCGCCATCACTGATAATCAGATCTGCCGGAAGTTGGCCAGACTTTAAAGCATTTTCT
 
. : . : . : . : . : . :
JMSF012D06+ AGCATTGCCACCTCTTCAAGAGTTTGGGAATTGACAATGGCAGCCTGCAGAAAAACGTAT
                      ____________________________________________________________
consensus AGCATTGCCACCTCTTCAAGAGTTTGGGAATTGACAATGGCAGCCTGCAGAAAAACGTAT
 
. : . : . : . : . : . :
JMSF012D06+ TCGTTAAACTAATAGAAATGTCATGTCTAAGAAAAAAATGTGAAGGGGATGGATCTAGCC
                      ____________________________________________________________
consensus TCGTTAAACTAATAGAAATGTCATGTCTAAGAAAAAAATGTGAAGGGGATGGATCTAGCC