Previous Contig 005299:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS080E04Sequence611005299 (3)
JMSF012D04Sequence336005299 (3)206012067 (2)gb:ATAC009326_15429223e-11Arabidopsis thaliana chromosome III P1 MZB10 genomic sequence, complete sequence
JMSF019D16Sequence490005299 (3)651012067 (2)gb:BT000440_16347182e-43Arabidopsis thaliana mRNA capping enzyme - like protein (At5g01290) mRNA, comple

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS080E04+ TACAGCACTAACTACATAATCCGCATGTTCAATGC
                      ____________________________________________________________
consensus TACAGCACTAACTACATAATCCGCATGTTCAATGC
 
. : . : . : . : . : . :
JMFS080E04+ TGTGTTCTACAATAGGCTCTTCTGATTCCTCCTCTAGTTGTTTTCTGAAGAACTCATCAT
                      ____________________________________________________________
consensus TGTGTTCTACAATAGGCTCTTCTGATTCCTCCTCTAGTTGTTTTCTGAAGAACTCATCAT
 
. : . : . : . : . : . :
JMFS080E04+ CATCGTCTGGTTGTGGTGATGCATTTAAGTCCATGCTGGCAATCATTCAAGATGCACCAT
JMSF019D16+ CAAGATGCACCAT
                      ____________________________________________________________
consensus CATCGTCTGGTTGTGGTGATGCATTTAAGTCCATGCTGGCAATCATTCAAGATGCACCAT
 
. : . : . : . : . : . :
JMFS080E04+ GACACATATACCAATAAGTGGCTAACAAATTTATTATGATTTATCAGCAATGCCACAGTG
JMSF019D16+ GACACATATACCAATAAGTGGCTAACAAATTTATTATGATTTATCAGCAATGCCACAGTG
                      ____________________________________________________________
consensus GACACATATACCAATAAGTGGCTAACAAATTTATTATGATTTATCAGCAATGCCACAGTG
 
. : . : . : . : . : . :
JMFS080E04+ AGACTACCTTCCGAGTCCCACAAGCCAATGAATTCCAACTCCCAGTGAAACGTTTGAACC
JMSF019D16+ AGACTACCTTCCGAGTCCCACAAGCCAATGAATTCCAACTCCCAGTGAAACGTTTGAACC
                      ____________________________________________________________
consensus AGACTACCTTCCGAGTCCCACAAGCCAATGAATTCCAACTCCCAGTGAAACGTTTGAACC
 
. : . : . : . : . : . :
JMFS080E04+ CAAGGACAAAAATTTGTATATGTATTACAGACCCCTCTATGAAAAAATAAAAACCCTATA
JMSF019D16+ CAAGGACAAAAATTTGTATATGTATTACAGACCCCTCTATGAAAAAATAAAAACCCTATA
JMSF012D04+ CAGACCCCTCTATGAAAAAATAAAANCCCTATA
                      ____________________________________________________________
consensus CAAGGACAAAAATTTGTATATGTATTACAGACCCCTCTATGAAAAAATAAAAACCCTATA
 
. : . : . : . : . : . :
JMFS080E04+ TAATTGAGGTGAAAAAGCAAGAATCTTAATCAGCAGAATTTCAGTTTCCAAAACCCTAGA
JMSF019D16+ TAATTGAGGTGAAAAAGCAAGAATCTTAATCAGCAGAATTTCAGTTTCCAAAACCCTAGA
JMSF012D04+ TAATTGAGGTGAAAAAGCAAGAATCTTAATCAGCAGAATTTCAGTTTCCAAAACCCTAGA
                      ____________________________________________________________
consensus TAATTGAGGTGAAAAAGCAAGAATCTTAATCAGCAGAATTTCAGTTTCCAAAACCCTAGA
 
. : . : . : . : . : . :
JMFS080E04+ GACAAAAGCCCCGCTGTTATAGAGAGTTAAAGAGACGAGGAGATCGCATAGATTTTGTTG
JMSF019D16+ GACAAAAGCCCCGCTGTTATAGAGAGTTAAAGAGACGAGGAGATCGCATAGATTTTGTTG
JMSF012D04+ GACAAAAGCCCCGCTGTTATAGAGAGTTAAAGAGACGAGGAGATCGCATAGATTTTGTTG
                      ____________________________________________________________
consensus GACAAAAGCCCCGCTGTTATAGAGAGTTAAAGAGACGAGGAGATCGCATAGATTTTGTTG
 
. : . : . : . : . : . :
JMFS080E04+ CAGCTGTTCAATCCAGGTTTAGAACGAGAACCCATTCAAGAGAGGGGGGAAAATCAGAAA
JMSF019D16+ CAGCTGTTCAATCCAGGTTTAGAACGAGAACCCATTCAAGAGAGGGGGGAAAATCAGAAA
JMSF012D04+ CAGCTGTTCAATCCAGGTTTAGAACGAGAACCCATTCAAGAGAGGGGGGAAAATCAG-AA
                      ____________________________________________________________
consensus CAGCTGTTCAATCCAGGTTTAGAACGAGAACCCATTCAAGAGAGGGGGGAAAATCAGAAA
 
. : . : . : . : . : . :
JMFS080E04+ AAAAATGGGGGAAATTATTATGGGAAAAAAGAGAGATACATGTTGTGTACGTATATGTGA
JMSF019D16+ AAAAATGGGGGAAATTATTATGGGAAAAAAGAGAGATACATGTTGTGTACGTATATGTGA
JMSF012D04+ AAAAATGGGGGAAATTATTATGGGAAAAAAGAGAGATACATGTTGTGTACGTATATGTGA
                      ____________________________________________________________
consensus AAAAATGGGGGAAATTATTATGGGAAAAAAGAGAGATACATGTTGTGTACGTATATGTGA
 
. : . : . : . : . : . :
JMFS080E04+ GAATTCATGAATCGGTTGGAGAGAAGTGAGAAGGGA
JMSF019D16+ GAATTCATGAATCGGTTGGAGAGAAGTGAGAAGGGAGATTGGGCGAGGGTTGCGAAC
JMSF012D04+ GAATTCATGAATCGGTTGGAGAGAAGTGAGAAGGGAGATTGGGCGAGGGTTGCGAACGTC
                      ____________________________________________________________
consensus GAATTCATGAATCGGTTGGAGAGAAGTGAGAAGGGAGATTGGGCGAGGGTTGCGAACGTC