Previous Contig 005298:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF042A06Sequence642005298 (5)gb:AY098984_15765443e-63Arabidopsis thaliana AT5g10050/T31P16_40 mRNA, complete cds.>gb:AF424590_1798929622005298 (5)gb:AK117542_18155723e-32Arabidopsis thaliana At5g65205 mRNA for unknown protein, complete cds, clone: RA
JMFF050D04Sequence637005298 (5)gb:AK119053_18169983e-64Arabidopsis thaliana At5g10050 mRNA for unknown protein, complete cds, clone: RA426021891
JMSF012D03Sequence336005298 (5)gb:AK119053_18169981e-16Arabidopsis thaliana At5g10050 mRNA for unknown protein, complete cds, clone: RA766005298 (5)gb:AK117542_18155722e-49Arabidopsis thaliana At5g65205 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF042A06- GTGAAAAACTTAATATTTTTTAGTTAAAATATCAT
rJMSF012D03- TATATGATAAGTCTTGTGTGAAAAACTTAATATTTTTTAGTTAAAATATCAT
                      ____________________________________________________________
consensus TATATGATAAGTCTTGTGTGAAAAACTTAATATTTTTTAGTTAAAATATCAT
 
. : . : . : . : . : . :
rJMFF042A06- -GTCATATACTTTCACCCAAAAGTATTACGTATCTCACGTAATTACACACAAAATTTATT
rJMSF012D03- GGTCATATACTTTCACCCAAAAGTATTACGTATCTCACGTAATTACACACAAAATTTATT
                      ____________________________________________________________
consensus GGTCATATACTTTCACCCAAAAGTATTACGTATCTCACGTAATTACACACAAAATTTATT
 
. : . : . : . : . : . :
rJMFF042A06- CCAATATAAAATGCACACCAAAATAAGAAGTAGATCGAAATAAAGTTCGAGGGAGTAGTA
rJMSF012D03- CCAATATAAAATGCACACCAAAATAAGAAGTAGATCGAAATAAAGTTCGAGGGAATAGTA
                      ____________________________________________________________
consensus CCAATATAAAATGCACACCAAAATAAGAAGTAGATCGAAATAAAGTTCGAGGGAGTAGTA
 
. : . : . : . : . : . :
rJMFF042A06- GTTCATTTCATTATATTGGAGTGCAATATAATCAACCCTCCATTCCTTTCCTGGCGATAA
rJMSF012D03- GTTCATTTCATTATATTGGAGTGCAATATAATCAACCCTCCATTCCTTTCCTGGCGATAA
                      ____________________________________________________________
consensus GTTCATTTCATTATATTGGAGTGCAATATAATCAACCCTCCATTCCTTTCCTGGCGATAA
 
. : . : . : . : . : . :
rJMFF042A06- AATCCTTAACAAACAGTGGGAGGTGATGGAGAAGAGATGCAGCCATAGAGAGATGACCAG
rJMSF012D03- AATCCTTAACAAACAGTGGGAGGTGATGGAGAAGAGATGCAGCCATAGAGAGATGACCAG
                      ____________________________________________________________
consensus AATCCTTAACAAACAGTGGGAGGTGATGGAGAAGAGATGCAGCCATAGAGAGATGACCAG
 
. : . : . : . : . : . :
rJMFF042A06- CAGAGAACCATGGCGGCGGCTTCTTCTTCAGCACTACATTCACCGTCCTCTTTGCAAACT
rJMSF012D03- CAGAGAACCATGGCGGCGGCTTCTTCTTCAGCACTACATTCACCGTCCTCTTTGCAAACT
                      ____________________________________________________________
consensus CAGAGAACCATGGCGGCGGCTTCTTCTTCAGCACTACATTCACCGTCCTCTTTGCAAACT
 
. : . : . : . : . : . :
rJMFF042A06- CTTCTGTAGGGGTTGACCTTGCTGTACTTTGCGAGAAGCGTGCTCTCGCTTGGATTGCTT
rJMSF012D03- CTTCTGTAGGGGTTGACCTTGCTGTACTTTGCGAGAAGCGTGCTCTCGCTTGGATTGCTT
                      ____________________________________________________________
consensus CTTCTGTAGGGGTTGACCTTGCTGTACTTTGCGAGAAGCGTGCTCTCGCTTGGATTGCTT
 
. : . : . : . : . : . :
rJMFF042A06- CTTCAAATTGCTGGTACAACTTCCATTGCGACACCCCATTGTTGTTGCAGCTGGCAATAG
rJMSF012D03- CTTCAAATTGCTGGTACAACTTCCATTGCGACACCCCATTGTTGTTGCAGCTGGCAATAG
JMFF050D04+ GCAATAG
JMFF042A06+ G
                      ____________________________________________________________
consensus CTTCAAATTGCTGGTACAACTTCCATTGCGACACCCCATTGTTGTTGCAGCTGGCAATAG
 
. : . : . : . : . : . :
rJMFF042A06- CGGAGTTTCCTATGTTGGACTTCACAAGTCCGGGGACAACATTTATGACATCGATCCCAA
rJMSF012D03- CGGAGTTTCCTATGTTGGACTTCACAAGTCCGGGGACAACATTTATGACATCGATCCCAA
JMFF050D04+ CGGAGTTTCCTATGTTGGACTTCACAAGTCCGGGGACAACATTTATGACATCGATCCCAA
JMFF042A06+ CGGAGTTTCCTATGTTGGACTTCACAAGTCCGGGGACAACATTTATGACATCGATCCCAA
                      ____________________________________________________________
consensus CGGAGTTTCCTATGTTGGACTTCACAAGTCCGGGGACAACATTTATGACATCGATCCCAA
 
. : . : . : . : . : . :
rJMFF042A06- ATGGCCGGAGTTCCAGTCTCAAGGCATCAGTTAGGGCGTGGAGAGCAGCTTTTGAAGAAC
rJMSF012D03- ATGGCCGGAGTTCCAGTCTCAAGGCATCAGTTAGGGCGTGGAGAGCAGCTTTTGAAGAAC
JMFF050D04+ ATGGCCGGAGTTCCAGTCTCAAGGCATCAGTTAGGGCGTGGAGAGCAGCTTTTGAAGAAC
JMFF042A06+ ATGGCCGGAGTTCCAGTCTCAAGGCATCAGTTAGGGCGTGGAGAGCAGCTTTTGAAGAAC
                      ____________________________________________________________
consensus ATGGCCGGAGTTCCAGTCTCAAGGCATCAGTTAGGGCGTGGAGAGCAGCTTTTGAAGAAC
 
. : . : . : . : . : . :
rJMFF042A06- TGTAACCAGCTGCAAACGGTGCAGGGGCAAAGGCAACAATACTTCCA
rJMSF012D03- TGTAACCAGCTGCAAACGGTGCAGGGGCAAAGGCAACAATACTTCCAACGTTTACAATCT
JMFF050D04+ TGTAACCAGCTGCAAACGGTGCAGGGGCAAAGGCAACAATACTTCCAACGTTTACAATCT
JMFF042A06+ TGTAACCAGCTGCAAACGGTGCAGGGGCAAAGGCAACAATACTTCCAACGTTTACAATCT
                      ____________________________________________________________
consensus TGTAACCAGCTGCAAACGGTGCAGGGGCAAAGGCAACAATACTTCCAACGTTTACAATCT
 
. : . : . : . : . : . :
rJMSF012D03- TTCCTTTCCTCCTGGACGCCATGTGAGGAACCACAGCTTGAACTAACCTCAACGGACCCA
JMFF050D04+ TTCCTTTCCTCCTGGACGCCATGTGAGGAACCACAGCTTGAACTAACCTCAACGGACCCA
JMFF042A06+ TTCCTTTCCTCCTGGACGCCATGTGAGGAACCACAGCTTGAACTAACCTCAACGGACCCA
                      ____________________________________________________________
consensus TTCCTTTCCTCCTGGACGCCATGTGAGGAACCACAGCTTGAACTAACCTCAACGGACCCA
 
. : . : . : . : . : . :
rJMSF012D03- AGACGTTGGTATCGTAAGTGTTTTGAATGGCAGATAAGGGGATCTCACCTACAG
JMFF050D04+ AGACGTTGGTATCGTAAGTGTTTTGAATGGCAGATAAAGGGATCTCACCTACAGGCCCAA
JMFF042A06+ AGACGTTGGTATCGTAAGTGTTTTGAATGGCAGATAAAGGGATCTCACCTACAGGCCCAA
                      ____________________________________________________________
consensus AGACGTTGGTATCGTAAGTGTTTTGAATGGCAGATAAAGGGATCTCACCTACAGGCCCAA
 
. : . : . : . : . : . :
JMFF050D04+ TACAGTGCACTCCCGCATTGTTGACCACAACATCAATCTGCCCAAACTTCTCAACAACCT
JMFF042A06+ TACAGTGCACTCCCGCATTGTTGACCACAACATCAATCTGCCCAAACTTCTCAACAACCT
JMSF012D03+ CCACAACATCAATCTGCCCAAACTTCTCAACAACTT
                      ____________________________________________________________
consensus TACAGTGCACTCCCGCATTGTTGACCACAACATCAATCTGCCCAAACTTCTCAACAACCT
 
. : . : . : . : . : . :
JMFF050D04+ CAGAAACCACGCGCCTTACTTTCTGCTCAGACTGAACGTCCAGTTCTTGCAGGTGAAACC
JMFF042A06+ CAGAAACCACGCGCCTTACTTTCTGCTCAGACTGAACGTCCAGTTCTTGCAGGTGAAACC
JMSF012D03+ CAGAAACCACGCGCCTTACTTTCTGCTCAGACTGAACGTCCAGTTCTTGCAGGTGAAACC
                      ____________________________________________________________
consensus CAGAAACCACGCGCCTTACTTTCTGCTCAGACTGAACGTCCAGTTCTTGCAGGTGAAACC
 
. : . : . : . : . : . :
JMFF050D04+ TGGGGTCATTTTCTAAGTCGGACATGGCGGATCGTGACCGAGCTGTGGCCACCACCATGC
JMFF042A06+ TGGGGTCATTTTCTAAGTCGGACATGGCGGATCGTGACCGAGCTGTGGCCACCACCATGC
JMSF012D03+ TGGGGTCATTTTCTAAGTCGGACATGGCGGATCGTGACCGAGCTGTGGCCACCACCATGC
                      ____________________________________________________________
consensus TGGGGTCATTTTCTAAGTCGGACATGGCGGATCGTGACCGAGCTGTGGCCACCACCATGC
 
. : . : . : . : . : . :
JMFF050D04+ AATTCTCGGCGGCGAAAGCTTGTGCCAAAGCATGCCCAATTCCACCCTTTGAACACCCTG
JMFF042A06+ AATTCTCGGCGGCGAAAGCTTGTGCCAAAGCATGCCCAATTCCACCCTTTGAACACCCTG
JMSF012D03+ AATTCTCGGCGGCGAAAGCTTGTGCCAAAGCATGCCCAATTCCACCCTTTGAACACCCTG
                      ____________________________________________________________
consensus AATTCTCGGCGGCGAAAGCTTGTGCCAAAGCATGCCCAATTCCACCCTTTGAACACCCTG
 
. : . : . : . : . : . :
JMFF050D04+ TTATCAGAACTACTGCTTTGGTGTCCTTTTGATCCATTCAGAATTCAAATTTATGGAAGG
JMFF042A06+ TTATCAGAACTACTGCTTTGGTGTCCTTTTGATCCATTCAGAATTCAAATTTATGGAAGG
JMSF012D03+ TTATCAGAACTACTGCTTTGGTGTCCTTTTGATCCATTCAGAATTCAAATTTATGGAAGG
                      ____________________________________________________________
consensus TTATCAGAACTACTGCTTTGGTGTCCTTTTGATCCATTCAGAATTCAAATTTATGGAAGG
 
. : . : . : . : . : . :
JMFF050D04+ AGTTGTGATCTCAACATACACAC
JMFF042A06+ AGTTGTGATCTCAACATACACACATTTGGATGACTAGTTTG
JMSF012D03+ AGTTGTGATCTCAACATACACACATTTGGATGACTAGTTTGAAAAATAAGAAAATCACCA
                      ____________________________________________________________
consensus AGTTGTGATCTCAACATACACACATTTGGATGACTAGTTTGAAAAATAAGAAAATCACCA