Previous Contig 005297:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024E10Sequence349005297 (8)pir|S52385|S523855e-42NADH2 dehydrogenase (ubiquinone) (EC 1.6.5.3) chain TYKY.2 precursor - potato>gb767005297 (8)pir|C86302|C863027e-75probable NADH-ubiquinone oxidoreductase [imported] - Arabidopsis thaliana>gb:AE0
JMFN020O18Sequence546005297 (8)pir|C86302|C863028e-59probable NADH-ubiquinone oxidoreductase [imported] - Arabidopsis thaliana>gb:AE0
JMFN035N11Sequence639005297 (8)pir|S52385|S523852e-95NADH2 dehydrogenase (ubiquinone) (EC 1.6.5.3) chain TYKY.2 precursor - potato>gb
JMSF002A18Sequence222005297 (8)pir|S52385|S523853e-08NADH2 dehydrogenase (ubiquinone) (EC 1.6.5.3) chain TYKY.2 precursor - potato>gb749005297 (8)sp|P80269|NUIM_SOLTU2e-96NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial precursor (EC 1.6.5
JMSF012C23Sequence236005297 (8)pir|S52385|S523858e-11NADH2 dehydrogenase (ubiquinone) (EC 1.6.5.3) chain TYKY.2 precursor - potato>gb728005297 (8)sp|P80269|NUIM_SOLTU8e-94NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial precursor (EC 1.6.5

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF024E10- GNATGGGATTGATTATGCAGGTC
                      ____________________________________________________________
consensus GNATGGGATTGATTATGCAGGTC
 
. : . : . : . : . : . :
rJMFF024E10- CAGACTCCAGAACTGCAAGGCAGCTACCACCTTTACATTGCTATTATTTCCTACTTAAAA
                      ____________________________________________________________
consensus CAGACTCCAGAACTGCAAGGCAGCTACCACCTTTACATTGCTATTATTTCCTACTTAAAA
 
. : . : . : . : . : . :
rJMFF024E10- CCCTTCCAAAGATTGGGTATACAAGAGGAACTAGATCAATGAACAAAAGATGTGTGTTGC
rJMSF002A18- GATGTGTGTTGC
                      ____________________________________________________________
consensus CCCTTCCAAAGATTGGGTATACAAGAGGAACTAGATCAATGAACAAAAGATGTGTGTTGC
 
. : . : . : . : . : . :
JMFN020O18+ ACATTAAGTATATGATTTTTGGATCAAATGTCTAAAAGACAAAATCATAGCTATCTCC
rJMFF024E10- CAACATTAAGTATATGATTTTTGGATCAAATGTCTAAAAGACAAAATCATAGCTATCTCC
rJMSF002A18- C-ACATTAAGTATATGATTTTTGGATCAAATGTCTAAAAGACAAAATCATAGCTATCTCC
rJMSF012C23- TATATGATTTTTGGATCAAATGTCTAAAAGACAAAATCATAGCTATCTCC
                      ____________________________________________________________
consensus CAACATTAAGTATATGATTTTTGGATCAAATGTCTAAAAGACAAAATCATAGCTATCTCC
 
. : . : . : . : . : . :
JMFN020O18+ AGCATTAGGGAAGGAAAAAAGAACAAAGCATAGCAAGGATAAACAAATCCTTTTATTTAT
rJMFF024E10- AGCATTAGGGAAGGAAAAAAGAACAAAGCATAGCAAGGATAAACAAATCCTTTTATTTAT
rJMSF002A18- AGCATTAGGGAAGGAAAAAAGAACAAAGCATAGCAAGGATAAACAAATCCTTTTATTTAT
rJMSF012C23- AGCATTAGGGAAGGAAAAAAGAACAAAGCATAGCAAGGATAAACAAATCCTTTTATTTAT
                      ____________________________________________________________
consensus AGCATTAGGGAAGGAAAAAAGAACAAAGCATAGCAAGGATAAACAAATCCTTTTATTTAT
 
. : . : . : . : . : . :
JMFN020O18+ CATGGTCCTCATGCAAGTGAATCCAAGTTTATGTTCTTGCAGCGAAGGATCACTCAACGA
rJMFF024E10- CATGGTCCTCATGCAAGTGAATCCAAGTTTATGTTCTTGCAGCGAAGGATCACTCAACGA
rJMSF002A18- CATGGTCCTCATGCAAGTGAATCCAAGTTTATGTTCTTGCAGCGAAGGATCACTCAACGA
rJMSF012C23- CATGGTCCTCATGCAAGTGAATCCAAGTTTATGTTCTTGCAGCGAAGGATCACTCAACGA
                      ____________________________________________________________
consensus CATGGTCCTCATGCAAGTGAATCCAAGTTTATGTTCTTGCAGCGAAGGATCACTCAACGA
 
. : . : . : . : . : . :
JMFN020O18+ TAGAGACTTTCGGATCTCAGATTCTCTGCAATCTCAGTTTCCCAACGGTCACCATTCTCG
rJMFF024E10- TAGAGACTTTCGGATCTCAGATTCTCTGCAATCTCAGTTTCCCAACGGTCACCATTCTCG
rJMSF002A18- TAGAGACTTTCGGATCTAAGATTCTCTGCAATCTCAGTTTCCCAACGGTCACCATTCTCG
rJMSF012C23- TAGAGACTTTCGGATCTCAGATTCTCTGCAATCTCAGTTTCCCAACGGTCACCATTCTCG
                      ____________________________________________________________
consensus TAGAGACTTTCGGATCTCAGATTCTCTGCAATCTCAGTTTCCCAACGGTCACCATTCTCG
 
. : . : . : . : . : . :
JMFN020O18+ AGCAGCTTCTCTTTGTCATAAAGAAGTTCCTCATGAGTCTCTGTTGCAAATTCAAAGTTG
rJMFF024E10- AGCAGCTTCTCTTTGTCATAAAGAAGTTCCTCATGAGTCTCTGTTGCAAATTCAAAGTTG
rJMSF002A18- AGCAGCTTCTCTTTGTCATAAAGAAGTTCCTCATGAGTCTCTGTTGCAAATTCAAAGTTG
rJMSF012C23- AGCAGCTTCTCTTTGTCATAAAGAAGTTCCTCATGAGTCTCTGTTGCAAATTCAAAGTTG
JMFN035N11+ TG
                      ____________________________________________________________
consensus AGCAGCTTCTCTTTGTCATAAAGAAGTTCCTCATGAGTCTCTGTTGCAAATTCAAAGTTG
 
. : . : . : . : . : . :
JMFN020O18+ GGCCCTTCAACAATGGCATCGACGGGGCAAGCCTCTTGGCAAAATCCACAGTAGATGCAT
rJMFF024E10- GGCCCTTCAACAATGGCATCGACGGGGCAAGCCTCTTGGCAAAATCCACAGTAGATGCAT
rJMSF002A18- GGCCCTTCAACAATGGCATCGACGGGGCAAGCCTCTTGGCAAAATCCACAGTAGATGCAT
rJMSF012C23- GGCCCTTCAACAATGGCATCGACGGGGCAAGCCTCTTGGCAAAATCCACAGTAGATGCAT
JMFN035N11+ GGCCCTTCAACAATGGCATCGACGGGGCAAGCCTCTTGGCAAAATCCACAGTAGATGCAT
                      ____________________________________________________________
consensus GGCCCTTCAACAATGGCATCGACGGGGCAAGCCTCTTGGCAAAATCCACAGTAGATGCAT
 
. : . : . : . : . : . :
JMFN020O18+ TTTGTCATGTCAATATCATACCTGGTAGTTCGTCGACTTCCATCTTCTCGCTCCTCAGCC
rJMFF024E10- TTTGTCATGTCAATATCATACCTGGTAGTTCGTCGACTTCCATCTTCTCGCTCCTCAGCC
rJMSF002A18- TTTGTCATGTCAATATCATACCTGGTAGTTCGTCGACTTCCATCTTCTCGCTCCTCAGCC
rJMSF012C23- TTTGTCATGTCAATATCATACCTGGTAGTTCGTCGACTTCCATCTTCTCGCTCCTCAGCC
JMFN035N11+ TTTGTCATGTCAATATCATACCTGGTAGTTCGTCGACTTCCATCTTCTCGCTCCTCAGCC
                      ____________________________________________________________
consensus TTTGTCATGTCAATATCATACCTGGTAGTTCGTCGACTTCCATCTTCTCGCTCCTCAGCC
 
. : . : . : . : . : . :
JMFN020O18+ TCAATAGTGATAGCTTGAGCAGGACAAATAGCTTCACAAAGTTTGCAGGCAATACAACGT
rJMFF024E10- TCAATAGTGATAGCTTGAGCAGGACAAATAGCTTCACAAAGTTTGCAGGCAATACAACGT
rJMSF002A18- TCAATAGTGATAGCTTGAGCAGGACAAATAGCTTCACAAAGTTTGCAGGCAATACAACGT
rJMSF012C23- TCAATAGTGATAGCTTGAGCAGGACAAATAGCTTCACAAAGTTTGCAGGCAATACAACGT
JMFN035N11+ TCAATAGTGATAGCTTGAGCAGGACAAATAGCTTCACAAAGTTTGCAGGCAATACAACGT
                      ____________________________________________________________
consensus TCAATAGTGATAGCTTGAGCAGGACAAATAGCTTCACAAAGTTTGCAGGCAATACAACGT
 
. : . : . : . : . : . :
JMFN020O18+ TCCTCTCCTGTTGGATAACGACGGAGGGCATGTTCTCCACGAAAGCGAGGGC-TAAAGGA
rJMFF024E10- TCCTCTCCTGTTGGATAACGACGGAGGGCATGTTCTCCACGAAAGCGAGGGCTTAAAGGA
rJMSF002A18- TCCTCTCCTGTTGGATAACGACGGAGGGCATGTTCTCCACGAAAGCGAGGGCTTAAAGGA
rJMSF012C23- TCCTCTCCTGTTGGATAACGACGGAGGGCATGTTCTCCACGAAAGCGAGGGCTTAAAGGA
JMFN035N11+ TCCTCTCCTGTTGGATAACGACGGAGGGCATGTTCTCCACGAAAGCGAGGGCTTAAAGGA
                      ____________________________________________________________
consensus TCCTCTCCTGTTGGATAACGACGGAGGGCATGTTCTCCACGAAAGCGAGGGCTTAAAGGA
 
. : . : . : . : . : . :
JMFN020O18+ CCCTT
rJMFF024E10- CCCTTCTCAAATGGATAGTTGATAGTGACTTTCGTGTCAAAGAAGTACTTGAGTGTCAGC
rJMSF002A18- CCCTTCTCAAATGGATAGTTGATAGTGACTTTCGTGTCAAAGAAGTACTTGAGTGTCAGC
rJMSF012C23- CCCTTCTCAAATGGATAGTTGATAGTGACTTTCGTGTCAAAGAAGTACTTGAGTGTCAGC
JMFF024E10+ TTGATAGTGACTTTCGTGTCAAAGAAGTACTTGAGTGTCAGC
JMFN035N11+ CCCTTCTCAAATGGATAGTTGATAGTGACTTTCGTGTCAAAGAAGTACTTGAGTGTCAGC
                      ____________________________________________________________
consensus CCCTTCTCAAATGGATAGTTGATAGTGACTTTCGTGTCAAAGAAGTACTTGAGTGTCAGC
 
. : . : . : . : . : . :
rJMFF024E10- ATCAGACCCCGAACCATTTCAGTC
rJMSF002A18- ATCAGACCCCGAACCATTTCAGTCAGAAATAGTGTATTAATGCTCCTCTCAAAAACAGAA
rJMSF012C23- ATCAGACCCCGAACCATTTCAGTCAGAAATAGTGTATTAATGCTCCTCTCAAAAACAGAA
JMFF024E10+ ATCAGACCCCGAACCATTTCAGTCAGAAATAGTGTATTAATGCTCCTCTCAAAAACAGAA
JMFN035N11+ ATCAGACCCCGAACCATTTCAGTCAGAAATAGTGTATTAATGCTCCTCTCAAAAACAGAA
                      ____________________________________________________________
consensus ATCAGACCCCGAACCATTTCAGTCAGAAATAGTGTATTAATGCTCCTCTCAAAAACAGAA
 
. : . : . : . : . : . :
rJMSF002A18- TTCCAATCTTTTGACAGTTCTTTTGCAAGCTGCTCTCTCTCTNCATCATCTTTGTCAGTT
rJMSF012C23- TTCCAATCTTTTGACAGTTCTTTTGCAAGCTGCTCTCTCTCTTCATCATCTTTGTCAGTT
JMFF024E10+ TTCCAATCTTTTGACAGTTCTTTTGCAAGCTGCTCTCTCTCTTCATCATCTTTGTCAGTT
JMFN035N11+ TTCCAATCTTTTGACAGTTCTTTTGCAAGCTGCTCTCTCTCTTCATCATCTTTGTCAGTT
                      ____________________________________________________________
consensus TTCCAATCTTTTGACAGTTCTTTTGCAAGCTGCTCTCTCTCTTCATCATCTTTGTCAGTT
 
. : . : . : . : . : . :
rJMSF002A18- GAAAACGAATGCTT
rJMSF012C23- G-AAACGAATGCTT
JMFF024E10+ GAAAACGAATGCTTTGTAGCAAATGATCGTGTACCATACAAGGTTCCATAATGGTTAGAG
JMFN035N11+ GAAAACGAATGCTTTATAGCAAATGATCGTGTACCATACAAGGTTCCATAATGGTTAGAG
JMSF002A18+ TAGCAAATGATCGTGTACCATACAAGGTTCCATAATGGTTAGAG
JMSF012C23+ ACGAATGCTTTGTAGCAAATGATCGTGTACCATACAAGGTTCCATAATGGTTAGAG
                      ____________________________________________________________
consensus GAAAACGAATGCTTTGTAGCAAATGATCGTGTACCATACAAGGTTCCATAATGGTTAGAG
 
. : . : . : . : . : . :
JMFF024E10+ CCTTGTAATGCTTGTCCTGCCAAAACAAGCTGCCGAGAACGAAGCGCAGACATCGATTTA
JMFN035N11+ CCTTGTAATGCTTGTCCTGCCAAAACAAGCTGCCGAGAACGAAGCGCAGACATCGATTTA
JMSF002A18+ CCTTGTAATGCTTGTCCTGCCAAAACAAGCTGCCGAGAACGAAGCGCAGACATCGATTTA
JMSF012C23+ CCTTGTAATGCTTGTCCTGCCAAAACAAGCTGCCGAGAACGAAGCGCAGACATCGATTTA
                      ____________________________________________________________
consensus CCTTGTAATGCTTGTCCTGCCAAAACAAGCTGCCGAGAACGAAGCGCAGACATCGATTTA
 
. : . : . : . : . : . :
JMFF024E10+ CGAGCTAAGATGAAAGCCATGGCCGATTCGATGCCGGAAAGATGCGAGGCGTTTCTCCGT
JMFN035N11+ CGAGCTAAGATGAAAGCCATGGCCGATTCGATGCCGGAAAGATGCGAGGCGTTTCTCCGT
JMSF002A18+ CGAGCTAAGATGAAAGCCATGGCCGATTCGATGCCGGAAAGATGCGAGGCGTTTCTCCGT
JMSF012C23+ CGAGCTAAGATGAAAGCCATGGCCGATTCGATGCCGGAAAGATGCGAGGCGTTTCTCCGT
                      ____________________________________________________________
consensus CGAGCTAAGATGAAAGCCATGGCCGATTCGATGCCGGAAAGATGCGAGGCGTTTCTCCGT
 
. : . : . : . : . : . :
JMFF024E10+ TCAAGTC
JMFN035N11+ TCAAGTCCAGGGAGATCGGAAAAGGAGTGTGGAGTA
JMSF002A18+ TCAAGTCCAGGGAGATCGGAAAAGGAGTGTGGAGTATGTATGCCAGCGAGTCCGAT
JMSF012C23+ TCAAGTCCAGGGAGATCGGAAAAGGAGTGTGGAGTATGTATGCCAGCGAGTCCGATTGTC
                      ____________________________________________________________
consensus TCAAGTCCAGGGAGATCGGAAAAGGAGTGTGGAGTATGTATGCCAGCGAGTCCGATTGTC