Previous Contig 005293:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044K10Sequence640005293 (10)gb:AE016959_10205995e-09Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06374003168 (13)gb:AB032538_15187101e-09Nicotiana tabacum A31 mRNA for chromomethylase-like protein, complete cds.
JMSF005A22Sequence280005293 (10)335012035 (4)
JMSF012C09Sequence201005293 (10)217003168 (13)gb:AB032538_15187102e-09Nicotiana tabacum A31 mRNA for chromomethylase-like protein, complete cds.
JMSF017K05Sequence540005293 (10)gb:AC104473_17376540.010Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1626B05, complete se786003168 (13)gb:AB032538_15187102e-75Nicotiana tabacum A31 mRNA for chromomethylase-like protein, complete cds.
JMSF022B21Sequence645005293 (10)gb:AE016959_10205994e-10Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06748003168 (13)gb:AB032538_15187108e-41Nicotiana tabacum A31 mRNA for chromomethylase-like protein, complete cds.
JMSF033E20Sequence679005293 (10)gb:AC104473_17376546e-13Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1626B05, complete se755003168 (13)gb:AB032538_15187103e-74Nicotiana tabacum A31 mRNA for chromomethylase-like protein, complete cds.
JMSF034E23Sequence720005293 (10)gb:AC104473_17376546e-17Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1626B05, complete se631003168 (13)gb:AY093416_15753467e-61Zea mays DNA methyltransferase 105 (dmt105) mRNA, complete cds.
JMSF040N20Sequence108005293 (10)809003168 (13)gb:AB032538_15187107e-82Nicotiana tabacum A31 mRNA for chromomethylase-like protein, complete cds.
JMSF042L22Sequence801005293 (10)gb:AB032538_15187101e-27Nicotiana tabacum A31 mRNA for chromomethylase-like protein, complete cds.738003168 (13)gb:AB032538_15187103e-74Nicotiana tabacum A31 mRNA for chromomethylase-like protein, complete cds.
JMSF044I06Sequence800005293 (10)gb:AB032538_15187101e-27Nicotiana tabacum A31 mRNA for chromomethylase-like protein, complete cds.807003168 (13)gb:AB032538_15187101e-83Nicotiana tabacum A31 mRNA for chromomethylase-like protein, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044I06+ TTCAGAAAAGAAGACACGCT
JMSF042L22+ CTTCAGAAAAGAAGACACGCT
                      ____________________________________________________________
consensus CTTCAGAAAAGAAGACACGCT
 
. : . : . : . : . : . :
JMSF044I06+ GTTTGTCAACAAACTCATCACAGCCTTTGATAACAGTGTCCTTGGCTCTATAGTACCATT
JMSF042L22+ GTTTGTCAACAAACTCATCACAGCCTTTGATAACAGTGTCCTTGGCTCTATAGTACCATT
                      ____________________________________________________________
consensus GTTTGTCAACAAACTCATCACAGCCTTTGATAACAGTGTCCTTGGCTCTATAGTACCATT
 
. : . : . : . : . : . :
JMSF044I06+ GAGCTGTAAAATAAAGTGCACCATCAACTGCTTCAAACATTTCTATAATTCTGCAGATGT
JMSF042L22+ GAGCTGTAAAATAAAGTGCACCATCAACTGCTTCAAACATTTCTATAATTCTGCAGATGT
JMSF034E23+ GAGCTGTAAAATAAAGTGCACCATCAACTGCTTCAAACATTTCTATAATTCTGCAGATGT
JMSF033E20+ TCTATAATTCTGCAGATGT
                      ____________________________________________________________
consensus GAGCTGTAAAATAAAGTGCACCATCAACTGCTTCAAACATTTCTATAATTCTGCAGATGT
 
. : . : . : . : . : . :
JMSF044I06+ AATTATCTTCACCCTCTCCAGCCTTAACATAAGCATCATCCCCAAGCTTATAAAACAGGC
JMSF042L22+ AATTATCTTCACCCTCTCCAGCCTTAACATAAGCATCATCCCCAAGCTTATAAAACAGGC
JMSF034E23+ AATTATCTTCACCCTCTCCAGCCTTAACATAAGCATCATCCCCAAGCTTATAAAACAGGC
JMSF033E20+ AATTATCTTCACCCTCTCCAGCCTTAACATAAGCATCATCCCCAAGCTTATAAAACAGGC
JMFF044K10+ AGCCTTAACATAAGCATCATCCCCAAGCTANTAAAACAGGC
JMSF022B21+ CTCCAGCCTTAACATAAGCATCATCCCCAAGCTTATAAAACAGGC
                      ____________________________________________________________
consensus AATTATCTTCACCCTCTCCAGCCTTAACATAAGCATCATCCCCAAGCTTATAAAACAGGC
 
. : . : . : . : . : . :
JMSF044I06+ CATCAACTTTTGCTGCTGTAAAATGTCTCTTAGCCTGAAGTACCCCAGCAAATTCATCTT
JMSF042L22+ CATCAACTTTTGCTGCTGTAAAATGTCTCTTAGCCTGAAGTACCCCAGCAAATTCATCTT
JMSF034E23+ CATCAACTTTTGCTGCTGTAAAATGTCTCTTAGCCTGAAGTACCCCAGCAAATTCATCTT
JMSF033E20+ CATCAACTTTTGCTGCTGTAAAATGTCTCTTAGCCTGAAGTACCCCAGCAAATTCATCTT
JMFF044K10+ CATCAACTTTTGCTGCTGTAAAATGTCTCTTAGCCTGAAGTACCCCAGCAAATTCATCTT
JMSF022B21+ CATCAACTTTTGCTGCTGTAAAATGTCTCTTAGCCTGAAGTACCCCAGCAAATTCATCTT
                      ____________________________________________________________
consensus CATCAACTTTTGCTGCTGTAAAATGTCTCTTAGCCTGAAGTACCCCAGCAAATTCATCTT
 
. : . : . : . : . : . :
JMSF044I06+ GGCTAGTTATACTCCTAGTTACACCATTTGATTTCTCAGTCCCCTTCTGGTAGCGGTGAG
JMSF042L22+ GGCTAGTTATACTCCTAGTTACACCATTTGATTTCTCAGTCCCCTTCTGGTAGCGGTGAG
JMSF034E23+ GGCTAGTTATACTCCTAGTTACACCATTTGATTTCTCAGTCCCCTTCTGGTAGCGGTGAG
JMSF033E20+ GGCTAGTTATACTCCTAGTTACACCATTTGATTTCTCAGTCCCCTTCTGGTAGCGGTGAG
JMFF044K10+ GGCTAGTTATACTCCTAGTTACACCATTTGATTTCTCAGTCCCCTTCTGGTAGCGGTGAG
JMSF022B21+ GGCTAGTTATACTCCTAGTTACACCATTTGATTTCTCAGTCCCCTTCTGGTAGCGGTGAG
JMSF017K05+ GGCTAGTTATACTCCTAGTTACACCATTTGATTTCTCAGTCCCCTTCTGGTAGCGGTGAG
                      ____________________________________________________________
consensus GGCTAGTTATACTCCTAGTTACACCATTTGATTTCTCAGTCCCCTTCTGGTAGCGGTGAG
 
. : . : . : . : . : . :
JMSF044I06+ GCCACCGCTGCTTCGCTTCCTCTTCCAAAACCGGACCCCCAACAAACTCACTGTCCTCAT
JMSF042L22+ GCCACCGCTGCTTCGCTTCCTCTTCCAAAACCGGACCCCCAACAAACTCACTGTCCTCAT
JMSF034E23+ GCCACCGCTGCTTCGCTTCCTCTTCCAAAACCGGACCCCCAACAAACTCACTGTCCTCAT
JMSF033E20+ GCCACCGCTGCTTCGCTTCCTCTTCCAAAACCGGACCCCCAACAAACTCACTGTCCTCAT
JMFF044K10+ GCCACCGCTGCTTCGCTTCCTCTTCCAAAACCGGACCCCCAACAAACTCACTGTCCTCAT
JMSF022B21+ GCCACCGCTGCTTCGCTTCCTCTTCCAAAACCGGACCCCCAACAAACTCACTGTCCTCAT
JMSF017K05+ GCCACCGCTGCTTCGCTTCCTCTTCCAAAACCGGACCCCCAACAAACTCACTGTCCTCAT
                      ____________________________________________________________
consensus GCCACCGCTGCTTCGCTTCCTCTTCCAAAACCGGACCCCCAACAAACTCACTGTCCTCAT
 
. : . : . : . : . : . :
JMSF044I06+ CGTTCGTCACGTTAGTCGTGATCCGTTTCCGCTCCGGCGGCGAAGCCTGGCTCCGCACGA
JMSF042L22+ CGTTCGTCACGTTAGTCGTGATCCGTTTCCGCTCCGGCGGCGAAGCCTGGCTCCGCACGA
JMSF034E23+ CGTTCGTCACGTTAGTCGTGATCCGTTTCCGCTCCGGCGGCGAAGCCTGGCTCCGCACGA
JMSF033E20+ CGTTCGTCACGTTAGTCGTGATCCGTTTCCGCTCCGGCGGCGAAGCCTGGCTCCGCACGA
JMFF044K10+ CGTTCGTCACGTTAGTCGTGATCCGTTTCCGCTCCGGCGGCGAAGCCTGGCTCCGCACGA
JMSF022B21+ CGTTCGTCACGTTAGTCGTGATCCGTTTCCGCTCCGGCGGCGAAGCCTGGCTCCGCACGA
JMSF017K05+ CGTTCGTCACGTTAGTCGTGATCCGTTTCCGCTCCGGCGGCGAAGCCTGGCTCCGCACGA
                      ____________________________________________________________
consensus CGTTCGTCACGTTAGTCGTGATCCGTTTCCGCTCCGGCGGCGAAGCCTGGCTCCGCACGA
 
. : . : . : . : . : . :
JMSF044I06+ GGTTTCCACCAGCAACATCGTCCGATTCCTCCTCAGCCGCCGCAAGCTCTTCGTTCAACT
JMSF042L22+ GGTTTCCACCAGCAACATCGTCCGATTCCTCCTCAGCCGCCGCAAGCTCTTCGTTCAACT
JMSF034E23+ GGTTTCCACCAGCAACATCGTCCGATTCCTCCTCAGCCGCCGCAAGCTCTTCGTTCAACT
JMSF033E20+ GGTTTCCACCAGCAACATCGTCCGATTCCTCCTCAGCCGCCGCAAGCTCTTCGTTCAACT
JMFF044K10+ GGTTTCCACCAGCAACATCGTCCGATTCCTCCTCAGCCGCCGCAAGCTCTTCGTTCAACT
JMSF022B21+ GGTTTCCACCAGCAACATCGTCCGATTCCTCCTCAGCCGCCGCAAGCTCTTCGTTCAACT
JMSF017K05+ GGTTTCCACCAGCAACATCGTCCGATTCCTCCTCAGCCGCCGCAAGCTCTTCGTTCAACT
                      ____________________________________________________________
consensus GGTTTCCACCAGCAACATCGTCCGATTCCTCCTCAGCCGCCGCAAGCTCTTCGTTCAACT
 
. : . : . : . : . : . :
JMSF044I06+ CCGAGTCCTTTTCAGCCGAATCTACCACCGCCTTCCGCCTTCCCCTCTTCGACTTCCGGC
JMSF042L22+ CCGAGTCCTTTTCAGCCGAATCTACCACCGCCTTCCGCCTTCCCCTCTTCGACTTCCGGC
JMSF034E23+ CCGAGTCCTTTTCAGCCGAATCTACCACCGCCTTCCGCCTTCCCCTCTTCGACTTCCGGC
JMSF033E20+ CCGAGTCCTTTTCAGCCGAATCTACCACCGCCTTCCGCCTTCCCCTCTTCGACTTCCGGC
JMFF044K10+ CCGAGTCCTTTTCAGCCGAATCTACCACCGCCTTCCGCCTTCCCCCCTTCGACTTCCGGC
JMSF022B21+ CCGAGTCCTTTTCAGCCGAATCTACCACCGCCTTCCGCCTTCCCCTCTTCGACTTCCGGC
JMSF005A22+ TCTACCACCGCCTTCCGCCTTCCCCTCTTCGACTTCCGGC
JMSF017K05+ CCGAGTCCTTTTCAGCCGAATCTACCACCGCCTTCCGCCTTCCCCTCTTCGACTTCCGGC
                      ____________________________________________________________
consensus CCGAGTCCTTTTCAGCCGAATCTACCACCGCCTTCCGCCTTCCCCTCTTCGACTTCCGGC
 
. : . : . : . : . : . :
JMSF044I06+ TAGAATCCGAGTTCGTCGAAGCCTTCCTTTTGGCCGGCATTTCAACTGCACTGCCAGCAG
JMSF042L22+ TAGAATCCGAGTTCGTCGAAGCCTTCCTTTTGGCCGGCATTTCAACTGCGCTGCCAGCAG
JMSF034E23+ TAGAATCCGAGTTCGTCGAAGCCTTCCTTTTGGCCGGCATTTCAACTGCACTGCCAGCAG
JMSF033E20+ TAGAATCCGAGTTCGTCGAAGCCTTCCTTTTGGCCGGCATTTCAACTGCACTGCCAGCAG
JMFF044K10+ TAGAATCCGAGTTCGTCGAAGCCTTCCTTTTGGCCGGCATTTCAACTGCACTGCCAGCAG
JMSF022B21+ TAGAATCCGAGTTCGTCGAAGCCTTCCTTTTGGCCGGCATTTCAACTGCACTGCCAGCAG
JMSF005A22+ TAGAATCCGAGTTCGTCGAAGCCTTCCTTTTGGCCGGCATTTCAACTGCACTGCCAGCAG
JMSF017K05+ TAGAATCCGAGTTCGTCGAAGCCTTCCTTTTGGCCGGCATTTCAACTGCACTGCCAGCAG
JMSF012C09+ TTTCAACTGCACTGCCAGCAG
                      ____________________________________________________________
consensus TAGAATCCGAGTTCGTCGAAGCCTTCCTTTTGGCCGGCATTTCAACTGCACTGCCAGCAG
 
. : . : . : . : . : . :
JMSF044I06+ CCCCAACCACCTTAACCTCAGTAACATCCTCCGCCAGATCTCTAACCTTCTTCGGCCTTC
JMSF042L22+ CCCCAACCACCTTAACCTCAGTAACATCCTCCGCCAGATCTCTAACCTTCTTCGGCCTTC
JMSF034E23+ CCCCAACCACCTTAACCTCAGTAACATCCTCCGCCAGATCTCTAACCTTCTTCGGCCTTC
JMSF033E20+ CCCCAACCACCTTAACCTCAGTAACATCCTCCGCCAGATCTCTAACCTTCTTCGGCCTTC
JMFF044K10+ CCCCAACCACCTTAACCTCAGTAACATCCTCCGCCAGATCTCTAACCTTCTTCGGCCTTC
JMSF022B21+ CCCCAACCACCTTAACCTCAGTAACATCCTCCGCCAGATCTCTAACCTTCTTCGGCCTTC
JMSF005A22+ CCCCAACCACCTTAACCTCAGTAACATCCTCCGCCAGATCTCTAACCTTCTTCGGCCTTC
JMSF017K05+ CCCCAACCACCTTAACCTCAGTAACATCCTCCGCCAGATCTCTAACCTTCTTCGGCCTTC
JMSF012C09+ CCCCAACCACCTTAACCTCAGTAACATCCTCCGCCAGATCTCTAACCTTCTTCGGCCTTC
                      ____________________________________________________________
consensus CCCCAACCACCTTAACCTCAGTAACATCCTCCGCCAGATCTCTAACCTTCTTCGGCCTTC
 
. : . : . : . : . : . :
JMSF044I06+ CTCTGGTCGATTTCCTAGCGGAATTCGAACAGGTCTCCATAGCAAAGAGGTAGAAATGGG
JMSF042L22+ CTCTGGTCGATTTCCTAGCGGAATTCGAACAGGTCTCCATAGCAAAGAGGTAGAAATGGG
JMSF034E23+ CTCTGGTCGATTTCCTAGCGGAATTCGAACAGGTCTCCATAGCAAAGAGGTAGAAATGGG
JMSF033E20+ CTCTGGTCGATTTCCTAGCGGAATTCGAACAGGTCTCCATAGCAAAGAGGTAGAAATGGG
JMFF044K10+ CTCTGGTCGATTTCCTAGCGGAATTCGAACAGGTCTCCATAGCAAAGAGGTAGAAATGGG
JMSF022B21+ CTCTGGTCGATTTCCTAGCGGAATTCGAACAGGTCTCCATAGCAAAGAGGTAGAAATGGG
JMSF005A22+ CTCTGGTCGATTTCCTAGCGGAATTCGAACAGGTCTCCATAGCAAAGAGGTAGAAATGGG
JMSF017K05+ CTCTGGTCGATTTCCTAGCGGAATTCGAACAGGTCTCCATAGCAAAGAGGTAGAAATGGG
JMSF040N20+ TCCTAGCGGAATTCGAACAGGTCTCCATAGCAAAGAGGTAGAAATGGG
JMSF012C09+ CTCTGGTCGATTTCCTAGCGGAATTCGAACAGGTCTCCATAGCAAAGAGGTAGAAATGGG
                      ____________________________________________________________
consensus CTCTGGTCGATTTCCTAGCGGAATTCGAACAGGTCTCCATAGCAAAGAGGTAGAAATGGG
 
. : . : . : . : . : . :
JMSF044I06+ GAGTTTTTGTGTGGGTAGGGTTTTAAGCTGGGGAGCAGGAGGCGGTAGTAGTGTAGTA
JMSF042L22+ GAGTTTTTGTGTGGGTAGGGTTTTAAGCTGGGGAGCAGGAGGCGGTAGTAGTGTAGTACC
JMSF034E23+ GAGTTTTTGTGTGGGTAGGGTTTTAAGCTGGGGAGCAGGAGGCGGTAGTAGTGTAGTACC
JMSF033E20+ GAGTTTTTGTGTGGGTAGGGTTTTAAGCTGGGGAGCAGGAGGCGGTAGTAGTGTAGTACC
JMFF044K10+ GAGTTTTTGTGTGGGTAGGGTTTTAAGCTGGGGAGCAGGAGGCGGTAGTAGTGCAGTAC
JMSF022B21+ GAGTTTTTGTGTGGGTAGGGTTTTAAGCTGGGGAGCAGGAGGCGGTAGTAGTGTAGTACC
JMSF005A22+ GAGTTTTTGTGTGGGTAGGGTTTTAAGCTGGGGAGCAGGAGGCGGTAGTAGTGTAGTA
JMSF017K05+ GAGTTTTTGTGTGGGTAGGGTTTTAAGCTGGGGAGCAGGAGGCGGTAGTAGTGTAGTACC
JMSF040N20+ GAGTTTTTGTGTGGGTAGGGTTCTAAGCNGGGGAGCAGGAGGNGGTAGTAGTGTAGTACC
JMSF012C09+ GAGTTTTTGTGTGGGTAGGGTTTTAAGCTGGGGAGCAGGAGGCGGTAGTAGTGTAGTACC
                      ____________________________________________________________
consensus GAGTTTTTGTGTGGGTAGGGTTTTAAGCTGGGGAGCAGGAGGCGGTAGTAGTGTAGTACC