Previous Contig 005283:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF050F21Sequence623005283 (2)gb:AC084766_17337692e-13Oryza sativa chromosome 3 BAC OSJNBb0048D20 genomic sequence, complete sequence.604011666 (2)
JMSF012A09Sequence216005283 (2)718011666 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050F21+ GTTGAGCGAGAACCGTAACAGTAGCCC
                      ____________________________________________________________
consensus GTTGAGCGAGAACCGTAACAGTAGCCC
 
. : . : . : . : . : . :
JMFF050F21+ CGGAAGAAATCCTCAAATTCTCAATATTTTGGCCAGACACCCCAATCAAACCACCTGCTT
                      ____________________________________________________________
consensus CGGAAGAAATCCTCAAATTCTCAATATTTTGGCCAGACACCCCAATCAAACCACCTGCTT
 
. : . : . : . : . : . :
JMFF050F21+ GAGAACCAGCAATCAAAAACCTTACTGAATTTGCTGGCACATGCCCAGCACCAGCTTTCA
                      ____________________________________________________________
consensus GAGAACCAGCAATCAAAAACCTTACTGAATTTGCTGGCACATGCCCAGCACCAGCTTTCA
 
. : . : . : . : . : . :
JMFF050F21+ TTGCTTCAATGTTGCTCTCATCATCCTTTAGAATTAATGTCACAATTTGATGAAGGGCAC
                      ____________________________________________________________
consensus TTGCTTCAATGTTGCTCTCATCATCCTTTAGAATTAATGTCACAATTTGATGAAGGGCAC
 
. : . : . : . : . : . :
JMFF050F21+ TCTCAGCATCACAAAATGTGCCATCATTGTCTTTCGAACTGATGATGATAACCCTCTCTT
                      ____________________________________________________________
consensus TCTCAGCATCACAAAATGTGCCATCATTGTCTTTCGAACTGATGATGATAACCCTCTCTT
 
. : . : . : . : . : . :
JMFF050F21+ CATGTCTAGATATGGCGTCGGCTATCTTAATTGTAGCCCTGGTCTCCTCTCGAATCTTCT
                      ____________________________________________________________
consensus CATGTCTAGATATGGCGTCGGCTATCTTAATTGTAGCCCTGGTCTCCTCTCGAATCTTCT
 
. : . : . : . : . : . :
JMFF050F21+ GGATTCGATGCCCCACTTTACCAATAACCTTCCCGATCTGCTTCGACGGGACGATGATGC
                      ____________________________________________________________
consensus GGATTCGATGCCCCACTTTACCAATAACCTTCCCGATCTGCTTCGACGGGACGATGATGC
 
. : . : . : . : . : . :
JMFF050F21+ GGTACACAATATCCTGGGAAACCTTTACGCGCTTTTTCAACGGCGGCACGACCTCCGCCG
JMSF012A09+ TTACGCGCTTTTTCAACGGCGGCACGACCTCCGCCG
                      ____________________________________________________________
consensus GGTACACAATATCCTGGGAAACCTTTACGCGCTTTTTCAACGGCGGCACGACCTCCGCCG
 
. : . : . : . : . : . :
JMFF050F21+ AGGTGCCCGCCTCATCCGTCGCCTCAAAGGCATCCTCGTCGCGGCGGCGCTTTGCGGTTG
JMSF012A09+ AGGTGCCCGCCTCATCCGTCGCCTCAAAGGCATCCTCGTCGCGGCGGCGCTTTGCGGTTG
                      ____________________________________________________________
consensus AGGTGCCCGCCTCATCCGTCGCCTCAAAGGCATCCTCGTCGCGGCGGCGCTTTGCGGTTG
 
. : . : . : . : . : . :
JMFF050F21+ TGGACTTGTACGGATCGTCCTCCGTCGATGGAGCTCCTGGTGGCGGAGGGTTAGGGTTTA
JMSF012A09+ TGGACTTGTACGGATCGTCCTCCGTCGATGGAGCTCCTGGTGGCGGAGGGTTAGGGTTTA
                      ____________________________________________________________
consensus TGGACTTGTACGGATCGTCCTCCGTCGATGGAGCTCCTGGTGGCGGAGGGTTAGGGTTTA
 
. : . : . : . : . : . :
JMFF050F21+ GGCTGGTCTGGGTTGGCTGAGCTTGCTGAGCCATTGGTGGAGAGCGGTGCGAGCTT
JMSF012A09+ GGCTGGTCTGGGTTGGCTGAGCTTGCTGAGCCATTGGTGGAGAGCGGTGCGAGCTTGAGC
                      ____________________________________________________________
consensus GGCTGGTCTGGGTTGGCTGAGCTTGCTGAGCCATTGGTGGAGAGCGGTGCGAGCTTGAGC