Previous Contig 005281:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS026A07Sequence635005281 (7)gb:AE005172_8903811e-44Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC068197_154034
JMFS059H10Sequence624005281 (7)gb:AE005172_8903816e-57Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC068197_154034
JMSF009E10Sequence465005281 (7)gb:AE005172_8903814e-43Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC068197_154034781011664 (4)gb:AY842028_16306502e-61Arabidopsis thaliana putative purple acid phosphatase (PAP2) mRNA, complete cds.
JMSF011P15Sequence197005281 (7)761011664 (4)gb:AY842028_16306509e-49Arabidopsis thaliana putative purple acid phosphatase (PAP2) mRNA, complete cds.
JMSF015N16Sequence438005281 (7)gb:AY842028_16306503e-40Arabidopsis thaliana putative purple acid phosphatase (PAP2) mRNA, complete cds.814011664 (4)gb:AY842028_16306505e-63Arabidopsis thaliana putative purple acid phosphatase (PAP2) mRNA, complete cds.
JMSF028N10Sequence686005281 (7)gb:AE005172_8903817e-70Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC068197_154034763011664 (4)gb:AY842028_16306509e-50Arabidopsis thaliana putative purple acid phosphatase (PAP2) mRNA, complete cds.
JMSF038M01Sequence588005281 (7)gb:AE005172_8903812e-42Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC068197_154034

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF028N10+ TCACAAAAGAGTAAGTTG
                      ____________________________________________________________
consensus TCACAAAAGAGTAAGTTG
 
. : . : . : . : . : . :
JMSF028N10+ GGCTCCAACCTCCTCCATCACTGCCAACCTTATAATAATATCTCTTCCCTTTGGTCAAAT
                      ____________________________________________________________
consensus GGCTCCAACCTCCTCCATCACTGCCAACCTTATAATAATATCTCTTCCCTTTGGTCAAAT
 
. : . : . : . : . : . :
JMSF028N10+ TGGTCATCACACCATCATGTATATACCCAGGATCTCTCCACCCAACACTGTGATTAGCCG
JMFS059H10+ AGGATCTCTCCACCCAACACTGTGATTAGCCG
                      ____________________________________________________________
consensus TGGTCATCACACCATCATGTATATACCCAGGATCTCTCCACCCAACACTGTGATTAGCCG
 
. : . : . : . : . : . :
JMSF028N10+ GAGTATCACACATATGCTCTTTCTCGTACCTCCCTACCTCGGTACCCACCACATGATCCA
JMFS059H10+ GAGTATCACACATATGCTCTTTCTCGTACCTCCCTACCTCGGTACCCACCACATGATCCA
JMFS026A07+ CCA
                      ____________________________________________________________
consensus GAGTATCACACATATGCTCTTTCTCGTACCTCCCTACCTCGGTACCCACCACATGATCCA
 
. : . : . : . : . : . :
JMSF028N10+ GATTCCCCCGGGTCAACCCGTATCTCACAGAATTCTCCTTCCCATCAGGCGTCACGAACA
JMSF009E10+ GTCACGAACA
JMFS059H10+ GATTCCCCCGGGTCAACCCGTATCTCACAGAATTCTCCTTCCCATCAGGCGTCACGAACA
JMSF038M01+ TCCTTCCCATCAGGCGTCACGAACA
JMFS026A07+ GATTCCCCCGGGTCAACCCGTATCTCACAGAATTCTCCTTCCCATCAGGCGTCACGAACA
                      ____________________________________________________________
consensus GATTCCCCCGGGTCAACCCGTATCTCACAGAATTCTCCTTCCCATCAGGCGTCACGAACA
 
. : . : . : . : . : . :
JMSF028N10+ TGACACGCATCTCACCCTCCCGGCCCGTGACCGCGAGATGGACCTGTTCGGGGCCCCGCC
JMSF015N16+ TCCCGGCCCGTGACCGCGAGATGGACCTGTTCGGGGCCCCGCC
JMSF009E10+ TGACACGCATCTCACCCTCCCGGCCCGTGACCGCGAGATGGACCTGTTCGGGGCCCCGCC
JMFS059H10+ TGACACGCATCTCACCCTCCCGGCCCGTGACCGCGAGATGGACCTGTTCGGGGCCCCGCC
JMSF038M01+ TGACACGCATCTCACCCTCCCGGCCCGTGACCGCGAGATGGACCTGTTCGGGGCCCCGCC
JMFS026A07+ TGACACGCATCTCACCCTCCCGGCCCGTGACCGCGAGATGGACCTGTTCGGGGCNCCGCC
                      ____________________________________________________________
consensus TGACACGCATCTCACCCTCCCGGCCCGTGACCGCGAGATGGACCTGTTCGGGGCCCCGCC
 
. : . : . : . : . : . :
JMSF028N10+ CGGGCTCGAACCCGATCTCCTCGGACCGCGCCAGCAGGTGCTTGGTCCCGGGCAGCGGGT
JMSF015N16+ CGGGCTCGAACCCGAGCTCCTCGGACCGCGCCAGCAGGTGCTTGGTCCCGGGCAGCGGGT
JMSF009E10+ CGGGCTCGAACCCGAGCTCCTCGGACCGCGCCAGCAGGTGCTTGGTCCCGGGCAGCGGGT
JMFS059H10+ CGGGCTCGAACCCGATCTCCTCGGACCGCGCCAGCAGGTGCTTGGTCCCGGGCAGCGGGT
JMSF038M01+ CGGGCTCGAACCCGATCTCCTCGGACCGCGCCAGCAGGTGCTTGGTCCCGGGCAGCGGGT
JMFS026A07+ CGGGCTCGAACCCGATCTCCTCGGACCGCGCCAGCAGGTGCTTGGTCCCGGGCAGCGGGT
                      ____________________________________________________________
consensus CGGGCTCGAACCCGATCTCCTCGGACCGCGCCAGCAGGTGCTTGGTCCCGGGCAGCGGGT
 
. : . : . : . : . : . :
JMSF028N10+ TCTGGTCGTGGTCTTGGTGCTTCAGGTTGATCTCGGAGTCGGTCCATCGGAAGATCCGGA
JMSF015N16+ TCTGGTCGTGGTCTTGGTGCTTCAGGTTGATCTCGGAGTCGGTCCATCGGAAGATCCGGA
JMSF009E10+ TCTGGTCGTGGTCTTGGTGCTTCAGGTTGATCTCGGAGTCGGTCCATCGGAAGATCCGGA
JMFS059H10+ TCTGGTCGTGGTCTTGGTGCTTCAGGTTGATCTCGGAGTCGGTCCATCGGAAGATCCGGA
JMSF038M01+ TCTGGTCGTGGTCTTGGTGCTTCAGGTTGATCTCGGAGTCGGTCCATCGGAAGATCCGGA
JMFS026A07+ TCTGGTCGTGGTCTTGGTGCTTCAGGTTGATCTCGGAGTCGGTCCATCGGAAGATCCGGA
                      ____________________________________________________________
consensus TCTGGTCGTGGTCTTGGTGCTTCAGGTTGATCTCGGAGTCGGTCCATCGGAAGATCCGGA
 
. : . : . : . : . : . :
JMSF028N10+ ACTGGAACTTGGCCCGGAGGTTGATAAGCGGGAATGAAATGGAGCCTGATCCGGATTCCC
JMSF015N16+ ACTGGAACTTGGCCCGGAGGTTGATAAGCGGGAATGAAATGGAGCCTGATCCGGATTCCC
JMSF009E10+ ACTGGAACTTGGCCCGGAGGTTGATAAGCGGGAATGAAATGGAGCCTGATCCGGATTCCC
JMFS059H10+ ACTGGAACTTGGCCCGGAGGTTGATAAGCGGGAATGAAATGGAGCCTGATCCGGATTCCC
JMSF038M01+ ACTGGAACTTGGCCCGGAGGTTGATAAGCGGGAATGAAANGGAGCCTGATCCGGATTCCC
JMFS026A07+ ACTGGAACTTGGCCCGGAGGTTGATAAGCGGGAATGAAATGGAGCCTGATCCGGATTCCC
                      ____________________________________________________________
consensus ACTGGAACTTGGCCCGGAGGTTGATAAGCGGGAATGAAATGGAGCCTGATCCGGATTCCC
 
. : . : . : . : . : . :
JMSF028N10+ ATTCAGGCGAAGAAGAAAGGAAGAAGTAGCCGATGAAGTATCTGTTTGACGACTCGGGCG
JMSF015N16+ ATTCAGGCGAAGAAGAAAGGAAGAAGTAGCCGATGAAGTATCTGTTTGACGACTCGGGCG
JMSF009E10+ ATTCAGGCGAAGAAGAAAGGAAGAAGTAGCCGATGAAGTATCTGTTTGACGACTCGGGCG
JMFS059H10+ ATTCAGGCGAAGAAGAAAGGAAGAAGTAGCCGATGAAGTATCTGTTTGACGACTCGGGCG
JMSF038M01+ ATTCAGGCGAAGAAGAAAGGAAGAAGTAGCCGATGAAGTATCTGTTTGACGACTCGGGCG
JMFS026A07+ ATTCAGGCGAAGAAGAAAGGAAGAAGTAGCCGATGAAGTATCTGTTTGACGACTCGGGCG
                      ____________________________________________________________
consensus ATTCAGGCGAAGAAGAAAGGAAGAAGTAGCCGATGAAGTATCTGTTTGACGACTCGGGCG
 
. : . : . : . : . : . :
JMSF028N10+ GCGAGTAGATCCCAACCCAGTCAAGTTTCGACGGTGAATCAATGGCGGACCATCGGATCG
JMSF015N16+ GCGAGTAGATCCCAACCCAGTCAAGTTTCGACGGTGAATCAATGGCGGACCATCGGATCG
JMSF009E10+ GCGAGTAGATCCCAACCCAGTCAAGTTTCGACGGTGAATCAATGGCGGACCATCGGATCG
JMFS059H10+ GCGAGTAGATCCCAACCCAGTCAAGTTTCGACGGTGAATCAATGGCGGACCATCGGATCG
JMSF038M01+ GCGAGTAGATCCCAACCCAGTCAAGTTTCGACGGTGAATCAATGGCGGACCATCGGATCG
JMFS026A07+ GCGAGTAGATCCCAACCCAGTCAAGTTTCGACGGTGAATCAATGGCGGACCATCGGATCG
                      ____________________________________________________________
consensus GCGAGTAGATCCCAACCCAGTCAAGTTTCGACGGTGAATCAATGGCGGACCATCGGATCG
 
. : . : . : . : . : . :
JMSF028N10+ TAATTGAGTCGCCGGATTTTGGTACAGTCTTTGGGGTGACGGAGATAGAAACCTCTCCAA
JMSF015N16+ TAATTGAGTCGCCGGATTTTGGTACAGTCTTTGGGGTGACGGAGATAGAAACCTCTCCAA
JMSF009E10+ TAATTGAGTCGCCGGATTTTGGTACAGTCTTTGGGGTGACGGAGATAGAAACCTCTCCAA
JMFS059H10+ TAATTGAGTCGCCGGATTTTGGTACAGTCTTTGGGGTGACGGAGATAGAAACCTCTCCAA
JMSF038M01+ TAATTGAGTCNCCGGATTTTGGTACAGTCTTTGGGGTGACGGAGATAGAAACCTCTCCAA
JMFS026A07+ TAATTGAGTCGCCGGATTTTGGTACAGTCTTTGGGGTGACGGAGATAGAAACCTCTCCAA
JMSF011P15+ GATAGAAACNTCTCCAA
                      ____________________________________________________________
consensus TAATTGAGTCGCCGGATTTTGGTACAGTCTTTGGGGTGACGGAGATAGAAACCTCTCCAA
 
. : . : . : . : . : . :
JMSF028N10+ AAGAT
JMSF015N16+ AAGATGTGGAGGCGAAGAAGGAGAAAAGATTTAC
JMSF009E10+ AAGATGTGGAGGCGAAGAAGGAGAAAAGATTTAC
JMFS059H10+ AAGATGTGGAGGCGAAGAAGGAGAAAAGATTTACAAATAAAAGAGAGAAGAA
JMSF038M01+ AAGATGTGGAGGCGAAGAAGGAGAAAAGATTTACAAATAAAAGAGAGAAGAAGATTAGAG
JMFS026A07+ AAGATGTGGAGGCGAAGAAGGAGAAAAGATTTACAAATAAAAGAGAGAAGAAGATTAGAG
JMSF011P15+ AAGATGTGGAGGCGAAGAAGGAGAAAAGATTTACAAATAAAAGAGAGAAGAAGATTAGAG
                      ____________________________________________________________
consensus AAGATGTGGAGGCGAAGAAGGAGAAAAGATTTACAAATAAAAGAGAGAAGAAGATTAGAG
 
. : . : . : . : . : . :
JMSF038M01+ GGGTCATATTATCATAACTTTTCTTGAATTGGGTAATTAGAAATGTAGGGAGCTCTGATC
JMFS026A07+ GGGTCATATTATCATAACTTTTCTTGAATTGGGTAATTAGAAATGTAGGGAGCTCTGATC
JMSF011P15+ GGGTCATATTATCATAACTTTTCTTGAATTGGGTAATTAGAAATGTAGGGAGCTCTGATC
                      ____________________________________________________________
consensus GGGTCATATTATCATAACTTTTCTTGAATTGGGTAATTAGAAATGTAGGGAGCTCTGATC
 
. : . : . : . : . : . :
JMSF038M01+ CAGTATAGATGTGGTGGTGAA
JMFS026A07+ CAGTATAGATGTGGTGGTGAATGGTGATACAG
JMSF011P15+ CAGTATAGATGTGGTGGTGAATGGTGATACAGCCAGAGCCATACAGAATTATATTCTTCC
                      ____________________________________________________________
consensus CAGTATAGATGTGGTGGTGAATGGTGATACAGCCAGAGCCATACAGAATTATATTCTTCC