Previous Contig 005273:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021M01Sequence467005273 (4)sp|Q9SW96|SYN1_ARATH2e-47Asparaginyl-tRNA synthetase, cytoplasmic 1 (EC 6.1.1.22) (Asparagine-- tRNA liga658011653 (3)sp|Q9SW96|SYN1_ARATH2e-66Asparaginyl-tRNA synthetase, cytoplasmic 1 (EC 6.1.1.22) (Asparagine-- tRNA liga
JMFS049E09Sequence604005273 (4)sp|Q9SW96|SYN1_ARATH5e-69Asparaginyl-tRNA synthetase, cytoplasmic 1 (EC 6.1.1.22) (Asparagine-- tRNA liga
JMSF011N13Sequence345005273 (4)sp|Q9SW96|SYN1_ARATH5e-23Asparaginyl-tRNA synthetase, cytoplasmic 1 (EC 6.1.1.22) (Asparagine-- tRNA liga727011653 (3)sp|Q9SW96|SYN1_ARATH9e-72Asparaginyl-tRNA synthetase, cytoplasmic 1 (EC 6.1.1.22) (Asparagine-- tRNA liga
JMSF034F03Sequence652005273 (4)sp|Q9SW96|SYN1_ARATH1e-72Asparaginyl-tRNA synthetase, cytoplasmic 1 (EC 6.1.1.22) (Asparagine-- tRNA liga690011653 (3)sp|Q9SW96|SYN1_ARATH8e-72Asparaginyl-tRNA synthetase, cytoplasmic 1 (EC 6.1.1.22) (Asparagine-- tRNA liga

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034F03+ GCCTCACTAATTAAAGTTGTGACTTGAAACATCTCTCCAGCACCCTC
                      ____________________________________________________________
consensus GCCTCACTAATTAAAGTTGTGACTTGAAACATCTCTCCAGCACCCTC
 
. : . : . : . : . : . :
JMSF034F03+ ACAATCACTGGTGGTAACGATTGGAGTATGGACATATAAAAACCCATGCTTTTGGAAGAA
JMFS049E09+ GTAACGATTGGAGTATGGACATATAAAAACCCATGCTTTTGGAAGAA
                      ____________________________________________________________
consensus ACAATCACTGGTGGTAACGATTGGAGTATGGACATATAAAAACCCATGCTTTTGGAAGAA
 
. : . : . : . : . : . :
JMSF034F03+ TGTGTGAGTGGCATATGCCAGGGCATTGCGGATTCTTGCAAGTGAAGAAATAGTGTTGGT
JMFS049E09+ TGTGTGAGTGGCATATGCCAGGGCATTGCGGATTCTTGCAAGTGAAGAAATAGTGTTGGT
                      ____________________________________________________________
consensus TGTGTGAGTGGCATATGCCAGGGCATTGCGGATTCTTGCAAGTGAAGAAATAGTGTTGGT
 
. : . : . : . : . : . :
JMSF034F03+ TAGCGAGCGAAGATGAACAACA-CCCGAAGAAACTCAAGTGTGAGTTTGGTCTTCGGCAA
JMFF021M01+ CCGAAGAAACTCAAGTGTGAGTTTGGTCTTCGGCAA
JMFS049E09+ TCGCGAGCGAAGATGAACAACATCCCGAAGAAACTCAAGTGTGAGTTTGGTCTTCGGCAA
                      ____________________________________________________________
consensus TCGCGAGCGAAGATGAACAACATCCCGAAGAAACTCAAGTGTGAGTTTGGTCTTCGGCAA
 
. : . : . : . : . : . :
JMSF034F03+ AGGATATTTAGCAGCATCGACAGTACCAACCGCGATGACCTTCTGAACCCGAAGCTCGAC
JMFF021M01+ AGGATATTTAGCAGCATCGACAGTACCAACCGCGATGACCTTCTGAACCCGAAGCTCGAC
JMFS049E09+ AGGATATTTAGCAGCATCGACAGTACCAACCGCGATGACCTTCTGAACCCGAAGCTCGAC
                      ____________________________________________________________
consensus AGGATATTTAGCAGCATCGACAGTACCAACCGCGATGACCTTCTGAACCCGAAGCTCGAC
 
. : . : . : . : . : . :
JMSF034F03+ CTTCTGCTTCGTGCCTTCAGGGGGCAACTTCAGCAGTCCCTCCACGTGAACGCATGTCCC
JMFF021M01+ CTTCTGCTTCGTGCCTTCAGGGGGCAACTTCAGCAGTCCCTCCACGTGAACGCATGTCCC
JMFS049E09+ CTTCTGCTTCGTGCCTTCAGGGGGCAACTTCAGCAGTCCCTCCACGTGAACGCATGTCCC
                      ____________________________________________________________
consensus CTTCTGCTTCGTGCCTTCAGGGGGCAACTTCAGCAGTCCCTCCACGTGAACGCATGTCCC
 
. : . : . : . : . : . :
JMSF034F03+ CGTAGCAACCAAATCACCGAGCTTGTGAACGGCAGCGTCGACGATGACCTGTAGATTCGC
JMFF021M01+ CGTAGCAACCAAATCACCGAGCTTGTGAACGGCAGCGTCGACGATGACCTGTAGATTCGC
JMFS049E09+ CGTAGCAACCAAATCACCGAGCTTGTGAACGGCAGCGTCGACGATGACCTGTAGATTCGC
JMSF011N13+ ACCGAGCTTGTGAACGGCAGCGTCGACGATGACCTGTAGATTCGC
                      ____________________________________________________________
consensus CGTAGCAACCAAATCACCGAGCTTGTGAACGGCAGCGTCGACGATGACCTGTAGATTCGC
 
. : . : . : . : . : . :
JMSF034F03+ CGGGCACGACCCGTCATTCACTTCCAGGAATGCAAACGCCCCCTTCCCTTGCTCCCTGCC
JMFF021M01+ CGGGCACGACCCGTCATTCACTTCCAGGAATGCAAACGCCCCCTTCCCTTGCTCCCTGCC
JMFS049E09+ CGGGCACGACCCGTCATTCACTTCCAGGAATGCAAACGCCCCCTTCCCTTGCTCCCTGCC
JMSF011N13+ CGGGCACGACCCGTCATTCACTTCCAGGAATGCAAACGCCCCCTTCCCTTGCTCCCTGCC
                      ____________________________________________________________
consensus CGGGCACGACCCGTCATTCACTTCCAGGAATGCAAACGCCCCCTTCCCTTGCTCCCTGCC
 
. : . : . : . : . : . :
JMSF034F03+ GGTTTTAACCCATCCACCAATTTTGACGACTTGGCCGGCGAGTCCAGCTCCGGCGTCTGG
JMFF021M01+ GGTTTTAACCCATCCACCAATTTTGACGACTTGGCCGGCGAGTCCAGCTCCGGCGTCTGG
JMFS049E09+ GGTTTTAACCCATCCACCAATTTTGACGACTTGGCCGGCGAGTCCAGCTCCGGCGTCTGG
JMSF011N13+ GGTTTTAACCCATCCACCAATTTTGACGACTTGGCCGGCGAGTCCAGCTCCGGCGTCTGG
                      ____________________________________________________________
consensus GGTTTTAACCCATCCACCAATTTTGACGACTTGGCCGGCGAGTCCAGCTCCGGCGTCTGG
 
. : . : . : . : . : . :
JMSF034F03+ ACGGCCAAGAATAGACTTTATCAGGACTCGTTGTGAGAACTCTGCTTTAGCGACGGAGTC
JMFF021M01+ ACGGCCAAGAATAGACTTTATCAGGACTCGTTGTGAGAACTCTGCTTTAGCGACGGAGTC
JMFS049E09+ ACGGCCAAGAATAGACTTTATCAGGACTCGTTGTGAGAACTCTGCTTTAGCGACGGAGTC
JMSF011N13+ ACGGCCAAGAATAGACTTTATCAGGACTCGTTGTGAGAACTCTGCTTTAGCGACGGAGTC
                      ____________________________________________________________
consensus ACGGCCAAGAATAGACTTTATCAGGACTCGTTGTGAGAACTCTGCTTTAGCGACGGAGTC
 
. : . : . : . : . : . :
JMSF034F03+ GCTCAGGGAGAGCTTGTCCACCGGCGGCGTGGAATCAACTGACATTTTCGCGTTGATTTC
JMFF021M01+ GCTCAGGGAGAGCTTGTCCACCGGCGGCGTGGAATCAACTGACATTTTCGCGTTGATTTC
JMFS049E09+ GCTCAGGGAGAGCTTGTCCACCGGCGGCGTGGAATCAACTGACATTTTCGCGTTGATTTC
JMSF011N13+ GCTCAGGAAGAGCTTGTCCACCGGCGGCGTGGAATCAACTGACATTTTCGCGTTGATTTC
                      ____________________________________________________________
consensus GCTCAGGGAGAGCTTGTCCACCGGCGGCGTGGAATCAACTGACATTTTCGCGTTGATTTC
 
. : . : . : . : . : . :
JMSF034F03+ CCGTC
JMFF021M01+ CCGTC
JMFS049E09+ CCGTCAAGCAC
JMSF011N13+ CCGTCAAGCACTCAAAGCTGTAGAGTGTAGAGGGTTTTTTACGAATAGGGTTTTTGCATC
                      ____________________________________________________________
consensus CCGTCAAGCACTCAAAGCTGTAGAGTGTAGAGGGTTTTTTACGAATAGGGTTTTTGCATC