Previous Contig 005264:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011K17Sequence418005264 (2)gb:AF417483_17982823e-13Zea mays origin recognition complex subunit 3 (orc3) mRNA, complete cds.735011642 (2)gb:AB100408_15262644e-31Oryza sativa (japonica cultivar-group) ORC3 mRNA for origin recognition complex3
JMSF025F11Sequence687005264 (2)gb:AY524002_16113992e-42Arabidopsis thaliana origin recognition complex protein 3 (ORC3) mRNA, complete 763011642 (2)gb:AY524002_16113993e-53Arabidopsis thaliana origin recognition complex protein 3 (ORC3) mRNA, complete

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025F11+ ATTTCCATGCNTGCTATGCCATGATGC
                      ____________________________________________________________
consensus ATTTCCATGCNTGCTATGCCATGATGC
 
. : . : . : . : . : . :
JMSF025F11+ TAAGAGGGAAATATCTGCTGCATCAATGTCTACCAAAAGAAACTGCTGCAATAAACTTCT
                      ____________________________________________________________
consensus TAAGAGGGAAATATCTGCTGCATCAATGTCTACCAAAAGAAACTGCTGCAATAAACTTCT
 
. : . : . : . : . : . :
JMSF025F11+ GAGACACCCTCCAATGCCATTTTTAGAACAGAAGTCCAAAGACGAAACAGTAGCCACATG
                      ____________________________________________________________
consensus GAGACACCCTCCAATGCCATTTTTAGAACAGAAGTCCAAAGACGAAACAGTAGCCACATG
 
. : . : . : . : . : . :
JMSF025F11+ GCATCCATGAGATGTCAAATGCAAACTGAGCTCTTCAAAAGTCAATATATCATCAACAAT
                      ____________________________________________________________
consensus GCATCCATGAGATGTCAAATGCAAACTGAGCTCTTCAAAAGTCAATATATCATCAACAAT
 
. : . : . : . : . : . :
JMSF025F11+ CTCCATATTTTTGGTGAAAACCAGGCCAGTGGATAATCTTTGAGATATGGCCCCACTATT
                      ____________________________________________________________
consensus CTCCATATTTTTGGTGAAAACCAGGCCAGTGGATAATCTTTGAGATATGGCCCCACTATT
 
. : . : . : . : . : . :
JMSF025F11+ ATTAAATAGAACTGGGTAAGAAAGACTGGTTTTGGCGGTAATCTCAGGGGTCCGGCTCGC
JMSF011K17+ TAAATAGAACTGGGTAAGAAAGACTGGTTTTGGCGGTAATCTCAGGGGTCCGGCTCGC
                      ____________________________________________________________
consensus ATTAAATAGAACTGGGTAAGAAAGACTGGTTTTGGCGGTAATCTCAGGGGTCCGGCTCGC
 
. : . : . : . : . : . :
JMSF025F11+ TTGTATTGCATCAAAAGACTCAATAACCCAGTTTCTTATCTCATCAAAGGCATCAGCATT
JMSF011K17+ TTGTATTGCATCAAAAGACTCAATAACCCAGTTTCTTATCTCATCAAAGGCATCAGCATT
                      ____________________________________________________________
consensus TTGTATTGCATCAAAAGACTCAATAACCCAGTTTCTTATCTCATCAAAGGCATCAGCATT
 
. : . : . : . : . : . :
JMSF025F11+ TATAGTCCTCAAGACGTCCTTGATGTTGGACTCAATTTTTGACCATACGGAATGAAAAGC
JMSF011K17+ TATAGTCCTCAAGACGTCCTTGATGTTGGACTCAATTTTTGACCATACGGAATGAAAAGC
                      ____________________________________________________________
consensus TATAGTCCTCAAGACGTCCTTGATGTTGGACTCAATTTTTGACCATACGGAATGAAAAGC
 
. : . : . : . : . : . :
JMSF025F11+ ATCCATTTTTCGATGAATATCACTGCTTGTTTCAGATTCATTGGCTGCGGATTTGGTCTT
JMSF011K17+ ATCCATTTTTCGATGAATATCACTGCTTGTTTCAGATTCATTGGCTGCGGATTTGGTCTT
                      ____________________________________________________________
consensus ATCCATTTTTCGATGAATATCACTGCTTGTTTCAGATTCATTGGCTGCGGATTTGGTCTT
 
. : . : . : . : . : . :
JMSF025F11+ CTTCTTCCCCCGAATCGACTTGGCAGTAGAACTTCGAGGCTGTGAAGCTTTATGGAGAAC
JMSF011K17+ CTTCTTCCCCCGAATCGACTTGGTAGTAGAACTTCGAGGCTGTGAAGCTTTATGGAGAAC
                      ____________________________________________________________
consensus CTTCTTCCCCCGAATCGACTTGGTAGTAGAACTTCGAGGCTGTGAAGCTTTATGGAGAAC
 
. : . : . : . : . : . :
JMSF025F11+ AAAGAATGGCTGGAGGTTGTTTTCTGAGGCCTCGGAGGCGGAGGTTTCCGGCGGAAGATT
JMSF011K17+ AAAGAATGGCTGGAGGTTGTTTTCTGAGGCCTCGGAGGCGGAGGTTTCCGGCGGAAGATT
                      ____________________________________________________________
consensus AAAGAATGGCTGGAGGTTGTTTTCTGAGGCCTCGGAGGCGGAGGTTTCCGGCGGAAGATT
 
. : . : . : . : . : . :
JMSF025F11+ GTCAGCGCATGAAGACGAAGCCATTTCTGAGATCACGATGTGGCCACTCCAGCCTTACTC
JMSF011K17+ GTCAGCGCATGAAGACGAAGCCATTTCTGAGATCACGATGTGGCCACTCCAGCCTTACTC
                      ____________________________________________________________
consensus GTCAGCGCATGAAGACGAAGCCATTTCTGAGATCACGATGTGGCCACTCCAGCCTTACTC