Previous Contig 005261:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032P07Sequence549005261 (15)sp|P82538|TL26_ARATH3e-26Thylakoid lumenal 25.6 kDa protein, chloroplast precursor.>pir|T47672|T47672 hyp728005261 (15)gb:AP004396_18411405e-69Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P040
JMSF004K21Sequence318005261 (15)449005261 (15)gb:AY233206_15916846e-51Vitis vinifera putative oxygen evolving enhancer protein (PsbP2) mRNA, partial c
JMSF004P19Sequence251005261 (15)
JMSF011K11Sequence366005261 (15)748005261 (15)gb:AP004396_18411404e-70Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P040
JMSF019L11Sequence534005261 (15)sp|P82538|TL26_ARATH1e-25Thylakoid lumenal 25.6 kDa protein, chloroplast precursor.>pir|T47672|T47672 hyp753005261 (15)gb:AP004396_18411406e-71Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P040
JMSF038A03Sequence686005261 (15)gb:AP004396_18411402e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P040941005261 (15)gb:AP004396_18411409e-71Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P040
JMSF039A03Sequence677005261 (15)gb:AP004396_18411401e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P040818005261 (15)gb:AP004396_18411407e-71Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P040
JMSF050J06Sequence650005261 (15)gb:AP004396_18411402e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P040722005261 (15)gb:AP004396_18411407e-71Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P040

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF032P07- TCTTAATCATCATAATATGTATA
                      ____________________________________________________________
consensus TCTTAATCATCATAATATGTATA
 
. : . : . : . : . : . :
rJMFF032P07- AACCTTCCAAATGTGAGATCTGAGTTTTACTCTAAACAGATACAGAACCCTCT-GTAAAC
rJMSF039A03- AATGTGAGATCTGAGTTTTACTCTAAACAGATACAGAACCCTCT-GTAAAC
rJMSF019L11- GTGAGATCTGAGTTTTACTCTAAACAGATACAGAACCCTCT-GTAAAC
rJMSF011K11- GAACCCTCTGGTAAAC
rJMSF050J06- AATGTGAGATCTGAGTTTTACTCTAAACAGATACAGAACCCTCT-GTAAAC
rJMSF038A03- AATGTGAGATCTGAGTTTTACTCTAAACAGATACAGAACCCTCT-GTAAAC
                      ____________________________________________________________
consensus AACCTTCCAAATGTGAGATCTGAGTTTTACTCTAAACAGATACAGAACCCTCT-GTAAAC
 
. : . : . : . : . : . :
rJMSF004K21- AAGCCTCTAATCTCATCATCTCAGACAATAATATC
rJMFF032P07- TCATATCTAAATTGATTACAAATTAAAGCCTCTAATCTCATCATCTCAGACAATAATATC
rJMSF039A03- TCATATCTAAATTGATTACAAATTAAAGCCTCTAATCTCATCATCTCAGACAATAATATC
rJMSF019L11- TCATATCTAAATTGATTACAAATTAAAGCCTCTAATCTCATCATCTCAGACAATAATATC
rJMSF011K11- TCATATCTAAATTGATTACAAATTAAAGCCTCTAATCTCATCATCTCAGACAATAATATC
rJMSF050J06- TCATATCTAAATTGATTACAAATTAAAGCCTCTAATCTCATCATCTCAGACAATAATATC
rJMSF038A03- TCATATCTAAATTGATTACAAATTAAAGCCTCTAATCTCATCATCTCAGACAATAATATC
                      ____________________________________________________________
consensus TCATATCTAAATTGATTACAAATTAAAGCCTCTAATCTCATCATCTCAGACAATAATATC
 
. : . : . : . : . : . :
rJMSF004K21- TTATGAAATTTGGGATACAAACAATGAAGATGTGGGTGCAAATTACACATTGAAAATTTG
rJMFF032P07- TTATGAAATTTGGGATACAAACAATGAAGATGTGGGTGCAAATTACACATTGAAAATTTG
rJMSF039A03- TTATGAAATTTGGGATACAAACAATGAAGATGTGGGTGCAAATTACACATTGAAAATTTG
rJMSF019L11- TTATGAAATTTGGGATACAAACAATGAAGATGTGGGTGCAAATTACACATTGAAAATTTG
rJMSF011K11- TTATGAAATTTGGGATACAAACAATGAAGATGTGGGTGCAAATTACACATTGAAAATTTG
rJMSF050J06- TTATGAAATTTGGGATACAAACAATGAAGATGTGGGTGCAAATTACACATTGAAAATTTG
rJMSF038A03- TTATGAAATTTGGGATACAAACAATGAAGATGTGGGTGCAAATTACACATTGAAAATTTG
                      ____________________________________________________________
consensus TTATGAAATTTGGGATACAAACAATGAAGATGTGGGTGCAAATTACACATTGAAAATTTG
 
. : . : . : . : . : . :
rJMSF004K21- GAAGGAGTCCACCACAGTATGCAGTCTGTCTTTCATCTTCTCCCATCTCCTCTCATTCGC
rJMFF032P07- GAAGGAGTCCACCACAGTATGCAGTCTGTCTTTCATCTTCTCCCATCTCCTCTCATTCGC
rJMSF039A03- GAAGGAGTCCACCACAGTATGCAGTCTGTCTTTCATCTTCTCCCATCTCCTCTCATTCGC
rJMSF019L11- GAAGGAGTCCACCACAGTATGCAGTCTGTCTTTCATCTTCTCCCATCTCCTCTCATTCGC
rJMSF011K11- GAAGGAGTCCACCACAGTATGCAGTCTGTCTTTCATCTTCTCCCATCTCCTCTCATTCGC
rJMSF050J06- GAAGGAGTCCACCACAGTATGCAGTCTGTCTTTCATCTTCTCCCATCTCCTCTCATTCGC
rJMSF038A03- GAAGGAGTCCACCACAGTATGCAGTCTGTCTTTCATCTTCTCCCATCTCCTCTCATTCGC
                      ____________________________________________________________
consensus GAAGGAGTCCACCACAGTATGCAGTCTGTCTTTCATCTTCTCCCATCTCCTCTCATTCGC
 
. : . : . : . : . : . :
rJMSF004K21- CCCGGTTGTCAATGTATAGATCTTACCATTGCCTATGCAGACTGCGGTGAGAGCATGGCG
rJMFF032P07- CCCGGTTGTCAATGTATAGATCTTACCATTGCCTATGCAGACTGCGGTGAGAGCATGGCG
rJMSF039A03- CCCGGTTGTCAATGTATAGATCTTACCATTGCCTATGCAGACTGCGGTGAGAGCATGGCG
rJMSF019L11- CCCGGTTGTCAATGTATAGATCTTACCATTGCCTATGCAGACTGCGGTGAGAGCATGGCG
rJMSF011K11- CCCGGTTGTCAATGTATAGATCTTACCATTGCCTATGCAGACTGCGGTGAGAGCATGGCG
rJMSF050J06- CCCGGTTGTCAATGTATAGATCTTACCATTGCCTATGCAGACTGCGGTGAGAGCATGGCG
rJMSF038A03- CCCGGTTGTCAATGTATAGATCTTACCATTGCCTATGCAGACTGCGGTGAGAGCATGGCG
                      ____________________________________________________________
consensus CCCGGTTGTCAATGTATAGATCTTACCATTGCCTATGCAGACTGCGGTGAGAGCATGGCG
 
. : . : . : . : . : . :
rJMSF004K21- AGTGAAATTTGGTGCTTTCGCAACAAACTCAAACGTATAGTAGGCTTTCCCCTCTTCATC
rJMFF032P07- AGTGAAATTTGGTGCTTTCGCAACAAACTCAAACGTATAGTAGGCTTTCCCCTCTTCATC
rJMSF039A03- AGTGAAATTTGGTGCTTTCGCAACAAACTCAAACGTATAGTAGGCTTTCCCCTCTTCATC
rJMSF019L11- AGTGAAATTTGGTGCTTTCGCAACAAACTCAAACGTATAGTAGGCTTTCCCCTCTTCATC
rJMSF011K11- AGTGAAATTTGGTGCTTTCGCAACAAACTCAAACGTATAGTAGGCTTTCCCCTCTTCATC
rJMSF050J06- AGTGAAATTTGGTGCTTTCGCAACAAACTCAAACGTATAGTAGGCTTTCCCCTCTTCATC
rJMSF038A03- AGTGAAATTTGGTGCTTTCGCAACAAACTCAAACGTATAGTAGGCTTTCCCCTCTTCATC
JMSF039A03+ CTCAAACGTATAGTAGGCTTTCCCCTCTTCATC
JMSF038A03+ CGCAACAAACTCAAACGTATAGTAGGCTTTCCCNTCTTCATC
                      ____________________________________________________________
consensus AGTGAAATTTGGTGCTTTCGCAACAAACTCAAACGTATAGTAGGCTTTCCCCTCTTCATC
 
. : . : . : . : . : . :
rJMSF004K21- ACGCTCTTTCACCTCAATGAGTTTTGTTTTCTGAGAAGGTGAAGCCAAAACCTTTGTTAT
rJMFF032P07- ACGCTCTTTCACCTCAATGAGTTTTGTTTTCTGAGAAGGTGAAGCCAAAACCTTTGTTAT
rJMSF039A03- ACGCTCTTTCACCTCAATGAGTTTTGTTTTCTGAGAAGGTGAAGCCAAAACCTTTGTTAT
rJMSF019L11- ACGCTCTTTCACCTCAATGAGTTTTGTTTTCTGAGAAGGTGAAGCCAAAACCTTTGTTAT
rJMSF011K11- ACGCTCTTTCACCTCAATGAGTTTTGTTTTCTGAGAAGGTGAAGCCAAAACCTTTGTTAT
rJMSF050J06- ACGCTCTTTCACCTCAATGAGTTTTGTTTTCTGAGAAGGTGAAGCCAAAACCTTTGTTAT
rJMSF038A03- ACGCTCTTTCACCTCAATGAGTTTTGTTTTCTGAGAAGGTGAAGCCAAAACCTTTGTTAT
JMSF039A03+ ACGCTCTTTCACCTCAATGAGTTTTGTTTTCTGAGAAGGTGAAGCCAAAACCTTTGTTAT
JMSF038A03+ ACGCTCTTTCACCTCAATGAGTTTTGTTTTCTGAGAAGGTGAAGCCAAAACCTTTGTTAT
JMSF050J06+ ACCTCAATGAGTTTTGTTTTCTGAGAAGGTGAAGCCAAAACCTTTGTTAT
                      ____________________________________________________________
consensus ACGCTCTTTCACCTCAATGAGTTTTGTTTTCTGAGAAGGTGAAGCCAAAACCTTTGTTAT
 
. : . : . : . : . : . :
rJMSF004K21- TAAAGTTTCAGCAACTTCTTGTGCAGAACCAAAGTCCCGAATGTCTTGTTTGGTAGTCGG
rJMFF032P07- TAAAGTTTCAGCAACTTCTTGTGCAGAACCAAAGTCCCGAATGTCTTGTTTGGTAGTCGG
rJMSF039A03- TAAAGTTTCAGCAACTTCTTGTGCAGAACCAAAGTCCCGAATGTCTTGTTTGGTAGTCGG
rJMSF019L11- TAAAGTTTCAGCAACTTCTTGTGCAGAACCAAAGTCCCGAATGTCTTGTTTGGTAGTCGG
rJMSF011K11- TAAAGTTTCAGCAACTTCTTGTGCAGAACCAAAGTCCCGAATGTCTTGTTTGGTAGTCGG
rJMSF050J06- TAAAGTTTCAGCAACTTCTTGTGCAGAACCAAAGTCCCGAATGTCTTGTTTGGTAGTCGG
rJMSF038A03- TAAAGTTTCAGCAACTTCTTGTGCAGAACCAAAGTCCCGAATGTCTTGTTTGGTAGTCGG
JMSF039A03+ TAAAGTTTCAGCAACTTCTTGTGCAGAACCAAAGTCCCGAATGTCTTGTTTGGTAGTCGG
JMSF038A03+ TAAAGTTTCAGCAACTTCTTGTGCAGAACCAAAGTCCCGAATGTCTTGTTTGGTAGTCGG
JMSF019L11+ CGG
JMFF032P07+ TGGTAGTCGG
JMSF050J06+ TAAAGTTTCAGCAACTTCTTGTGCAGAACCAAAGTCCCGAATGTCTTGTTTGGTAGTCGG
                      ____________________________________________________________
consensus TAAAGTTTCAGCAACTTCTTGTGCAGAACCAAAGTCCCGAATGTCTTGTTTGGTAGTCGG
 
. : . : . : . : . : . :
rJMSF004K21- GAACACATTTACACTCACACTTTCTAGTGGTTCGATAACATCTTTGAAAACCTT
rJMFF032P07- GAACACATTTACACTCACACTTTCTAGTGGTTCGATAACATCTTTGAAAACCTTGTCCTG
rJMSF039A03- GAACACATTTACACTCACACTTTCTAGTGGTTCGATAACATCTTTGAAAACCTTGTCCTG
rJMSF019L11- GAACACATTTACACTCACACTTTCTAGTGGTTCGATAACATCTTTGAAAACCTTGTCCTG
rJMSF011K11- GAACACATTTACACTCACACTTTCTAGTGGTTCGATAACATCTTTGAAAACCTTGTCCTG
rJMSF050J06- GAACACATTTACACTCACACTTTCTAGTGGTTCGATAACATCTTTGAAAACCTTGTCCTG
rJMSF038A03- GAACACATTTACACTCACACTTTCTAGTGGTTCGATAACATCTTTGAAAACCTTGTCCTG
JMSF039A03+ GAACACATTTACACTCACACTTTCTAGTGGTTCGATAACATCTTTGAAAACCTTGTCCTG
JMSF038A03+ GAACACATTTACACTCACACTTTCTAGTGGTTCGATAACATCTTTGAAAACCTTGTCCTG
JMSF019L11+ GAACACATTTACACTCACACTTTCTAGTGGTTCGATAACATCTTTGAAAACCTTGTCCTG
JMFF032P07+ GAACACATTTACACTCACACTTTCTAGTGGTTCGATAACATCTTTGAAAACCTTGTCCTG
JMSF050J06+ GAACACATTTACACTCACACTTTCTAGTGGTTCGATAACATCTTTGAAAACCTTGTCCTG
                      ____________________________________________________________
consensus GAACACATTTACACTCACACTTTCTAGTGGTTCGATAACATCTTTGAAAACCTTGTCCTG
 
. : . : . : . : . : . :
rJMFF032P07- ACCTTCGACAACTACTTCCTGCCACCCAAAGGGATAGACAAAAGAGTATCCATCCTTCTT
rJMSF039A03- ACCTTCGACAACTACTTCCTGCCACCCAAAGGGATAGACAAAAGAGTATCCATCCTTCTT
rJMSF019L11- ACCTTCGACAACTACTTCCTGCCACCCAAAGGGATAGACAAAAGAGTATCCATCCTTCTT
rJMSF011K11- ACCTTCGACAACTACTTCCTGCCACCCAAAGGGATAGACAAAAGAGTATCCATCCTTCTT
rJMSF050J06- ACCTTCGACAACTACTTCCTGCCACCCAAAGGGATAGACAAAAGAGTATCCATCCTTCTT
rJMSF038A03- ACCTTCGACAACTACTTCCTGCCACCCAAAGGGATAGACAAAAGAGTATCCATCCTTCTT
JMSF039A03+ ACCTTCGACAACTACTTCCTGCCACCCAAAGGGATAGACAAAAGAGTATCCATCCTTCTT
JMSF038A03+ ACCTTCGACAACTACTTCCTGCCACCCAAAGGGATAGACAAAAGAGTATCCATCCTTCTT
JMSF019L11+ ACCTTCGACAACTACTTCCTGCCACCCAAAGGGATAGACAAAAGAGTATCCATCCTTCTT
JMFF032P07+ ACCTTCGACAACTACTTCCTGCCACCCAAAGGGATAGACAAAAGAGTATCCATCCTTCTT
JMSF050J06+ ACCTTCGACAACTACTTCCTGCCACCCAAAGGGATAGACAAAAGAGTATCCATCCTTCTT
                      ____________________________________________________________
consensus ACCTTCGACAACTACTTCCTGCCACCCAAAGGGATAGACAAAAGAGTATCCATCCTTCTT
 
. : . : . : . : . : . :
rJMFF032P07- GTCAGTGACTGGCAGAAATCCCTTCTTACTTTCTGCAGCAAACGATGTCTTAATCTGCAT
rJMSF039A03- GTCAGTGACTGGCAGAAATCCCTTCTTACTTTCTGCAGCAAACGATGTCTTAGTCTGCAT
rJMSF019L11- GTCAGTGACTGGCAGAAATCCCTTCTTACTTTCTGCAGCAAACGATGTCTTAGTCTGCAT
rJMSF011K11- GTCAGTGACTGGCAGAAATCCCTTCTTACTTTCTGCAGCAAACGATGTCTTAGTCTGCAT
rJMSF050J06- GTCAGTGACTGGCAGAAATCCCTTCTTACTTTCTGCAGCAAACGATGTCTTAGTCTGCAT
rJMSF038A03- GTCAGTGACTGGCAGAAATCCCTTCTTACTTTCTGCAGCAAACGATGTCTTAGTCTGCAT
JMSF039A03+ GTCAGTGACTGGCAGAAATCCCTTCTTACTTTCTGCAGCAAACGATGTCTTAGTCTGCAT
JMSF038A03+ GTCAGTGACTGGCAGAAATCCCTTCTTACTTTCTGCAGCAAACGATGTCTTAGTCTGCAT
JMSF019L11+ GTCAGTGACTGGCAGAAATCCCTTCTTACTTTCTGCAGCAAACGATGTCTTAGTCTGCAT
JMFF032P07+ GTCAGTGACTGGCAGAAATCCCTTCTTACTTTCTGCAGCAAACGATGTCTTAGTCTGCAT
JMSF050J06+ GTCAGTGACTGGCAGAAATCCCTTCTTACTTTCTGCAGCAAACGATGTCTTAGTCTGCAT
JMSF011K11+ CTGCAT
                      ____________________________________________________________
consensus GTCAGTGACTGGCAGAAATCCCTTCTTACTTTCTGCAGCAAACGATGTCTTAGTCTGCAT
 
. : . : . : . : . : . :
rJMFF032P07- AGAAATCAACAAGGGGCAAATAATTGCTCCCAAGGCAAGTACTTGA
rJMSF039A03- AGAAATCAACAAGGGGCAAATAATTGCTCCCAAGGCAAGTACTTGACGCCTTTGTGGTTG
rJMSF019L11- AGAAATCAACAAGGGGCAAATAATTGCTCCCAAGGCAAGTACTTGACGCCTTTGTGGTTG
rJMSF011K11- AGAAATCAACAAGGGGCAAATAATTGCTCCCAAGGCAAGTACTTGACGCCCTTGTGGTTG
rJMSF050J06- AGAAATCAACAAGGGGCAAATAATTGCTCCCAAGGCAAGTACTTGACGCCTTTGTGGTTG
rJMSF038A03- AGAAATCAACAAGGGGCAAATAATTGCTCCCAAGGCAAGTACTTGACGCCTTTGTGGTTG
JMSF039A03+ AGAAATCAACAAGGGGCAAATAATTGCTCCCAAGGCAAGTACTTGACGCCTTTGTGGTTG
JMSF038A03+ AGAAATCAACAAGGGGCAAATAATTGCTCCCAAGGCAAGTACTTGACGCCTTTGTGGTTG
JMSF019L11+ AGAAATCAACAAGGGGCAAATAATTGCTCCCAAGGCAAGTACTTGACGCCTTTGTGGTTG
JMSF004K21+ CAAGGCAAGTACTTGACGCCTTTGTGGTTG
JMFF032P07+ AGAAATCAACAAGGGGCAAATAATTGCTCCCAAGGCAAGTACTTGACGCCTTTGTGGTTG
JMSF050J06+ AGAAATCAACAAGGGGCAAATAATTGCTCCCAAGGCAAGTACTTGACGCCTTTGTGGTTG
JMSF011K11+ AGAAATCAACAAGGGGCAAATAATTGCTCCCAAGGCAAGTACTTGACGCCCTTGTGGTTG
                      ____________________________________________________________
consensus AGAAATCAACAAGGGGCAAATAATTGCTCCCAAGGCAAGTACTTGACGCCTTTGTGGTTG
 
. : . : . : . : . : . :
rJMSF039A03- ATCTGGGGAAGAGGAAGTTAAAGCCACAGGCACTTGCTCTGATCTGACAAGGAAGGAAGC
rJMSF019L11- ATCTGGGGAAGAGGAAGTTAAAGCCACAGGCACTTGCTCTGATCTG
rJMSF011K11- ATCTGGGGAAGAGGAAGTTAAAGCCACAGGCACTTGCTCTGATCTGACAAGGAAGGAAGC
rJMSF050J06- ATCT
rJMSF038A03- ATCTGGGGAAGAGGAAGTTAAAGCCACAGGCACTTGCTCTGATCTGACAAGGAAGGAAGC
JMSF039A03+ ATCTGGGGAAGAGGAAGTTAAAGCCACAGGCACTTGCTCTGATCTGACAAGGAAGGAAGC
JMSF038A03+ ATCTGGGGAAGAGGAAGTTAAAGCCACAGGCACTTGCTCTGATCTGACAAGGAAGGAAGC
JMSF019L11+ ATCTGGGGAAGAGGAAGTTAAAGCCACAGGCACTTGCTCTGATCTGACAAGGAAGGAAGC
JMSF004K21+ ATCTGGGGAAGAGGAAGTTAAAGCCACAGGCACTTGCTCTGATCTGACAAGGAAGGAAGC
JMSF004P19+ GATCTGACAAGGAAGGAAGC
JMFF032P07+ ATCTGGGGAAGAGGAAGTTAAAGCCACAGGCACTTGCTCTGATCTGACAAGGAAGGAAGC
JMSF050J06+ ATCTGGGGAAGAGGAAGTTAAAGCCACAGGCACTTGCTCTGATCTGACAAGGAAGGAAGC
JMSF011K11+ ATCTGGGGAAGAGGAAGTTAAAGCCACAGGCACTTGCTCTGATCTGACAAGGAAGGAAGC
                      ____________________________________________________________
consensus ATCTGGGGAAGAGGAAGTTAAAGCCACAGGCACTTGCTCTGATCTGACAAGGAAGGAAGC
 
. : . : . : . : . : . :
rJMSF039A03- GTGCCTGCGATTTTGGACATTTCTAAACAATCCTCCTAGC
rJMSF011K11- GTGCCTGCGATT
rJMSF038A03- GTGCCTGCGATTTTGGACATTTCTAAACAATCCTCCTAGCTGAGGGGATGCGCGGGGAAA
JMSF039A03+ GTGCCTGCGATTTTGGACATTTCTAAACAATCCTCCTAGCTGAGGGGATGCGCGGGGAAA
JMSF038A03+ GTGCCTGCGATTTTGGACATTTCTAAACAATCCTCCTAGCTGAGGGGATGCGCGGGGAAA
JMSF019L11+ GTGCCTGCGATTTTGGACATTTCTAAACAATCCTCCTAGCTGAGGGGATGCGCGGGGAAA
JMSF004K21+ GTGCCTGCGATTTTGGACATTTCTAAACAATCCTCCTAGCTGAGGGGATGCGCGGGGAAA
JMSF004P19+ GTGCCTGCGATTTTGGACATTTCTAAACAATCCTCCTAGCTGAGGGGATGCGCGGGGAAA
JMFF032P07+ GTGCCTGCGATTTTGGACATTTCTAAACAATCCTCCTAGCTGAGGGGATGCGCGGGGAAA
JMSF050J06+ GTGCCTGCGATTTTGGACATTTCTAAACAATCCTCCTAGCTGAGGGGATGCGCGGGGAAA
JMSF011K11+ GTGCCTGCGATTTTGGACATTTCTAAACAATCCTCCTAGCTGAGGGGATGCGCGGGGAAA
                      ____________________________________________________________
consensus GTGCCTGCGATTTTGGACATTTCTAAACAATCCTCCTAGCTGAGGGGATGCGCGGGGAAA
 
. : . : . : . : . : . :
rJMSF038A03- GCACGAATGATGGATTGTTTGAAACTCTTGCAATGACACCATTTCTCCTGCACTCTTGGC
JMSF039A03+ GCACGAATGATGGATTGTTTGAAACTCTTGCAATGACACCATTTCTCCTGCACTCTTGGC
JMSF038A03+ GCACGAATGATGGATTGTTTGAAACTCTTGCAATGACACCATTTCTCCTGCACTCTTGGC
JMSF019L11+ GCACGAATGATGGATTGTTTGAAACTCTTGCAATGACACCATTTCTCCTGCACTCTTGGC
JMSF004K21+ GCACGAATGATGGATTGTTTGAAACTCTTGCAATGACACCATTTCTCCTGCACTCTTGGC
JMSF004P19+ GCACGAATGATGGATTGTTTGAAACTCTTGCAATGACACCATTTCTCCTGCACTCTTGGC
JMFF032P07+ GCACGAATGATGGATTGTTTGAAACTCTTGCAATGACACCATTTCTCCTGCACTCTTGGC
JMSF050J06+ GCACGAATGATGGATTGTTTGAAACTCTTGCAATGACACCATTTCTCCTGCACTCTTGGC
JMSF011K11+ GCACGAATGATGGATTGTTTGAAACTCTTGCAATGACACCATTTCTCCTGCACTCTTGGC
                      ____________________________________________________________
consensus GCACGAATGATGGATTGTTTGAAACTCTTGCAATGACACCATTTCTCCTGCACTCTTGGC
 
. : . : . : . : . : . :
rJMSF038A03- TTAGGCGCCGGCGGTGGAATTTTACGGCGAGTGAGGCTGCCA
JMSF039A03+ TTAGGCGCCGGCGGTGGAATTTTACGGCGAGTGAGGCTGCCACGTGTCCGAGTGGGGGGT
JMSF038A03+ TTAGGCGCCGGCGGTGGAATTTTACGGCGAGTGAGGCTGCCACGTGTCCGAGTGGGGGGT
JMSF019L11+ TTAGGCGCCGGCGGTGGAATTTTACGGCGAGTGAGGCTGCCACGTGTCCGAGTGGGGGGT
JMSF004K21+ TTAGGCGCCGGCGGTGGAATTTTACGGCGAGTGAGGCTGCCACGTGTCCGAGTGGGGGGT
JMSF004P19+ TTAGGCGCCGGCGGTGGAATTTTACGGCGAGTGAGGCTGCCACGTGTCCGAGTGGGGGGT
JMFF032P07+ TTAGGCGCCGGCGGTGGAATTTTACGGCGAGTGAGGCTGCCACGTGTCCGAGTGGGGGGT
JMSF050J06+ TTAGGCGCCGGCGGTGGAATTTTACGGCGAGTGAGGCTGCCACGTGTCCGAGTGGGGGGT
JMSF011K11+ TTAGGCGCCGGCGGTGGAATTTTACGGCGAGTGAGGCTGCCACGTGTCCGAGTGGGGGGT
                      ____________________________________________________________
consensus TTAGGCGCCGGCGGTGGAATTTTACGGCGAGTGAGGCTGCCACGTGTCCGAGTGGGGGGT
 
. : . : . : . : . : . :
JMSF039A03+ TCTGTTTCTCCTTATTATCTTCTTCAGTTCTGCCTCGCACCAC
JMSF038A03+ TCTGTTTCTCCTTATTATCTTCTTCAGTTCTGCCTCGCACCAC
JMSF019L11+ TCTGTTTCTCCTTATTATCTTCTTCAGTTCTGCCTCGCACCACATCATCC
JMSF004K21+ TCTGTTTCTCCTTATTATCTTCTTCAGTTCTGCCTCGCACCACATC
JMSF004P19+ TCTGTTTCTCCTTATTATCTTCTTCAGTTCTGCCTCGCACCACATCATCC
JMFF032P07+ TCTGTTTCTCCTTATTATCTTCTTCAGTTCTGCCTCGCACCACATCATCCAAATCTCCC
JMSF050J06+ TCTGTTTCTCCTTATTATCTTCTTCAGTTCTGCCTCGCACCACATCATCCAAATCTCCC
JMSF011K11+ TCTGTTTCTCCTTATTATCTTCTTCAGTTCTGCCTCGCACCACATCATCCAAATCTCCCC
                      ____________________________________________________________
consensus TCTGTTTCTCCTTATTATCTTCTTCAGTTCTGCCTCGCACCACATCATCCAAATCTCCCC