Previous Contig 005253:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN046D24Sequence573005253 (5)gb:AB011474_15113502e-43Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2A18.
JMSF011J10Sequence457005253 (5)gb:AB011474_15113501e-05Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2A18.727005253 (5)gb:AP004776_18448923e-65Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P045
JMSF020D23Sequence630005253 (5)gb:AB011474_15113508e-57Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2A18.696005253 (5)gb:AP004776_18448921e-70Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P045

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF011J10- AGGCGNAATACAGAGATAATAAAAACTCA
                      ____________________________________________________________
consensus AGGCGNAATACAGAGATAATAAAAACTCA
 
. : . : . : . : . : . :
rJMSF011J10- ACAATGACATGTAAATAATATTAATGATAGCAATATACAAAAGCTCCAGGTAACAGAAAA
rJMSF020D23- ATATACAAAAGCTCCAGGTAACAGAAAA
                      ____________________________________________________________
consensus ACAATGACATGTAAATAATATTAATGATAGCAATATACAAAAGCTCCAGGTAACAGAAAA
 
. : . : . : . : . : . :
rJMSF011J10- TAATTTCCACCTACAAAGGGAGAACAGGAAAAAAGGAAAAAGAAAAAAAAAAAGTTATGA
rJMSF020D23- TAATTTCCACCTACAAAGGGAGAACAGGAAAAAAGGAAAAAG-AAAAAAAAAAGTTATGA
                      ____________________________________________________________
consensus TAATTTCCACCTACAAAGGGAGAACAGGAAAAAAGGAAAAAGAAAAAAAAAAAGTTATGA
 
. : . : . : . : . : . :
rJMSF011J10- GGGCTAAAATCAGGAATGACCGTANTAAGTGAGAGAGACTTGATGCCTGCCAGTGCCTGG
rJMSF020D23- GGGCTAAAATCAGGAATGACCGTAGTAAGTGAGAGAGACTTGATGCCNGCCAGTGCCNGG
                      ____________________________________________________________
consensus GGGCTAAAATCAGGAATGACCGTAGTAAGTGAGAGAGACTTGATGCCTGCCAGTGCCTGG
 
. : . : . : . : . : . :
rJMSF011J10- TGTGTCCAGAGATACCGAACAGNGGTTTCATACAAAATGGTACAACAGTAAGTCCATCCA
rJMSF020D23- NGTGTCCAGAGATACCGAACAGNGGTTTCATACAAAANGGTACAACAGTAAGTCCATCCA
                      ____________________________________________________________
consensus TGTGTCCAGAGATACCGAACAGNGGTTTCATACAAAATGGTACAACAGTAAGTCCATCCA
 
. : . : . : . : . : . :
rJMSF011J10- AATTCACATCTCAATCGTATGAGGTAAGTTAAGCCTTATACTCGCGAACTCGCATCCNTT
rJMSF020D23- AATTCACATCTCAATCGTATGAGGTAAGTTAAGCCTTATACTCGCGAACTCGCATCCATT
                      ____________________________________________________________
consensus AATTCACATCTCAATCGTATGAGGTAAGTTAAGCCTTATACTCGCGAACTCGCATCCATT
 
. : . : . : . : . : . :
rJMSF011J10- TTGTANATGACCACTTGTTCCCTTTAATGACAGGGCAACCNCCATGTAAACTGGATGGGT
rJMSF020D23- TTGTANATGACCACTTGTTCCCTTTAATGACAGGGCAACCACCATGTAAACTGGATGGGT
                      ____________________________________________________________
consensus TTGTANATGACCACTTGTTCCCTTTAATGACAGGGCAACCACCATGTAAACTGGATGGGT
 
. : . : . : . : . : . :
rJMSF011J10- CTAGAGATCCATCAGGTTTCATGCTCCANAAAAGCAATGCATCNCCCATCTTTGGTTTTA
rJMSF020D23- CTAGAGATCCATCAGGTTTCATGCTCCANAAAAGCAATGCATCACCCATCTTTGGTTTTA
                      ____________________________________________________________
consensus CTAGAGATCCATCAGGTTTCATGCTCCANAAAAGCAATGCATCACCCATCTTTGGTTTTA
 
. : . : . : . : . : . :
rJMSF011J10- CTGANAGTCCNCCTTTTCCACATTCANATAGTTCGTTCCNCCAAGGAACAGCAGAAATAT
rJMSF020D23- CTGANAGTCCACCTTTTCCACATTCANATAGTTCGTTCCACCAAGGAACAGCANAAATAT
                      ____________________________________________________________
consensus CTGANAGTCCACCTTTTCCACATTCANATAGTTCGTTCCACCAAGGAACAGCAGAAATAT
 
. : . : . : . : . : . :
rJMSF011J10- TTCCTTTGGCAGAAGGGAATACTGTTTCTCCCCCTTCTTCAACATCTGAAAGGTACATGA
rJMSF020D23- TTCCTTTGGCANAAGGGAATACNGTTTCTCCCCCTTCTTCAACATCTGAAAGGTACATGA
                      ____________________________________________________________
consensus TTCCTTTGGCAGAAGGGAATACTGTTTCTCCCCCTTCTTCAACATCTGAAAGGTACATGA
 
. : . : . : . : . : . :
rJMSF011J10- NAACTGTAGCAATACGCTGACCACCATTCTTCGTGTTGTAATCATCAAGAAAGTAATCAT
rJMSF020D23- NAACTGTAGCAATACGCTGACCACCATTCTTCGTGTTGTAATCATCAAGAAAGTAATCAT
                      ____________________________________________________________
consensus NAACTGTAGCAATACGCTGACCACCATTCTTCGTGTTGTAATCATCAAGAAAGTAATCAT
 
. : . : . : . : . : . :
rJMSF011J10- AGTGAGGTTCATACTTCTGGCCCACTTCATAATGGAGAATTTGAAGGCC
rJMSF020D23- AGTGAGGTTCATACTTCTGGCCCACTTCATAATGGAGAATTTGAAGGCCCTCACCATGTT
JMSF020D23+ CTTCATAATGGAGAATTTGAAGGCCCTCACCATGTT
                      ____________________________________________________________
consensus AGTGAGGTTCATACTTCTGGCCCACTTCATAATGGAGAATTTGAAGGCCCTCACCATGTT
 
. : . : . : . : . : . :
rJMSF020D23- CTGCGGGTATGAAGGTGAAATCTGCAATCCTTTTCTCAATATTCCTGATTATTTTATCAC
JMFN046D24+ AAATCTGCAATCCTTTTCTCAATATTCCTGATTATTTTATCAC
JMSF020D23+ CTGCGGGTATGAAGGTGAAATCTGCAATCCTTTTCTCAATATTCCTGATTATTTTATCAC
                      ____________________________________________________________
consensus CTGCGGGTATGAAGGTGAAATCTGCAATCCTTTTCTCAATATTCCTGATTATTTTATCAC
 
. : . : . : . : . : . :
rJMSF020D23- GT
JMFN046D24+ GTCCTCTATGAAGAAATGTTCCTGAGCTTGTTCGTACCCTGCTATCTTTGCTCTTCCCAG
JMSF020D23+ GTCCTCTATGAAGAAATGTTCCTGAGCTTGTTCGTACCCTGCTATCTTTGCTCTTCCCAG
                      ____________________________________________________________
consensus GTCCTCTATGAAGAAATGTTCCTGAGCTTGTTCGTACCCTGCTATCTTTGCTCTTCCCAG
 
. : . : . : . : . : . :
JMFN046D24+ TTTCACTATCAACAACAGTTGACTTTTGCATATGGGGTTTAGCAAGATTAATCAAATATT
JMSF020D23+ TTTCACTATCAACAACAGTTGACTTTTGCATATGGGGTTTAGCAAGATTAATCAAATATT
                      ____________________________________________________________
consensus TTTCACTATCAACAACAGTTGACTTTTGCATATGGGGTTTAGCAAGATTAATCAAATATT
 
. : . : . : . : . : . :
JMFN046D24+ CACATTCATACTTGGACAAGAAATTGTGATAAACAAAGGCTCGAGGCTCCCAGGAAATCA
JMSF020D23+ CACATTCATACTTGGACAAGAAATTGTGATAAACAAAGGCTCGAGGCTCCCAGGAAATCA
                      ____________________________________________________________
consensus CACATTCATACTTGGACAAGAAATTGTGATAAACAAAGGCTCGAGGCTCCCAGGAAATCA
 
. : . : . : . : . : . :
JMFN046D24+ CTTCAACCCAGCTATCTCCTTTTCTAACATCATCTTCTTCTTGCTCTTCTCTTTCGAGTG
JMSF020D23+ CTTCAACCCAGCTATCTCCTTTTCTAACATCATCTTCTTCTTGCTCTTCTCTTTCGAGTG
JMSF011J10+ CTAACATCATCTTCTTCNTGCTCTTCTCTTTCGAGTG
                      ____________________________________________________________
consensus CTTCAACCCAGCTATCTCCTTTTCTAACATCATCTTCTTCTTGCTCTTCTCTTTCGAGTG
 
. : . : . : . : . : . :
JMFN046D24+ TGTTGTGCGCGATTGTGCTGAGATCGTGTGCTTTCTGAGAGCCCCTGGAGCTGCTGGGAA
JMSF020D23+ TGTTGTGCGCGATTGTGCTGAGATCGTGTGCTTTCTGAGAGCCCCTGGAGCTGCTGGGAA
JMSF011J10+ TGTTGTGCGCGATTGTGCTGAGATCGTGTGCTTTCTGAGAGCCCCTGGAGCTGCTGGGAA
                      ____________________________________________________________
consensus TGTTGTGCGCGATTGTGCTGAGATCGTGTGCTTTCTGAGAGCCCCTGGAGCTGCTGGGAA
 
. : . : . : . : . : . :
JMFN046D24+ TCGAGAGAATTCCGAAAGCGAGGAGCATTAAAACGACCAAAGAGAGAATTGCAAACACGG
JMSF020D23+ TCGAGAGAATTCCGAAAGCGAGGAGCATTAAAACGACCAAAGAGAGAATTGCAAACACGG
JMSF011J10+ TCGAGAGAATTCCGAAAGCGAGGAGCATTAAAACGACCAAAGAGAGAATTGCAAACACGG
                      ____________________________________________________________
consensus TCGAGAGAATTCCGAAAGCGAGGAGCATTAAAACGACCAAAGAGAGAATTGCAAACACGG
 
. : . : . : . : . : . :
JMFN046D24+ CGAAAGCGGTGGTCGCCGACGACGTCGTTCTGCGTGGGAGCCCTCGGCCGTATTTCCCCT
JMSF020D23+ CGAAAGCGGTGGTCGCCAACGACGTCGTTCTGCGTGGGAGCCCTCGGCCGTATTTCCCCT
JMSF011J10+ CGAAAGCGGTGGTCGCCGACGACGTCGTTCTGCGTGGGAGCCCTCGGCCGTATTTCCCCT
                      ____________________________________________________________
consensus CGAAAGCGGTGGTCGCCGACGACGTCGTTCTGCGTGGGAGCCCTCGGCCGTATTTCCCCT
 
. : . : . : . : . : . :
JMFN046D24+ TCGCCATTGTTACAGCGTAAGCTCTGTAGTTCCGATCAAAATCTAGGGATTAAATTCAAA
JMSF020D23+ TCGCCATTGTTACAGCGTAAGCTCTGTAGTTCCGATCAAAATCTAGGGATTAAATTCAAA
JMSF011J10+ TCGCCATTGTTACAGCGTAAGCTCTGTAGTTCCGATCAAAATCTAGGGATTAAATTCAAA
                      ____________________________________________________________
consensus TCGCCATTGTTACAGCGTAAGCTCTGTAGTTCCGATCAAAATCTAGGGATTAAATTCAAA
 
. : . : . : . : . : . :
JMFN046D24+ GCCGTCGGAGAAACGGTTGCAGCTTATTTATACTCAGTTTGTCAACAATA
JMSF020D23+ GCCGTCGGAGAAACGGTTGCAGCTTATTTATACTCAGTTTGTCAACAATA
JMSF011J10+ GCCGTCGGAGAAACGGTTGCAGCTTATTTATACTCAGTTTGTCAACAATACACAGGGGAA
                      ____________________________________________________________
consensus GCCGTCGGAGAAACGGTTGCAGCTTATTTATACTCAGTTTGTCAACAATACACAGGGGAA
 
. : . : . : . : . : . :
JMSF011J10+ GATGCAAATGGAGCTGGTAGCAGAAGAAGAAGAGTTAACTGCGTACGCAATTTTGGAATT
                      ____________________________________________________________
consensus GATGCAAATGGAGCTGGTAGCAGAAGAAGAAGAGTTAACTGCGTACGCAATTTTGGAATT
 
. : . : . : . : . : . :
JMSF011J10+ TTCTATTGCAATGTTGACCTTTTACTTCCTGCTTTTTCTGAATCTACCCACAGATTAACC
                      ____________________________________________________________
consensus TTCTATTGCAATGTTGACCTTTTACTTCCTGCTTTTTCTGAATCTACCCACAGATTAACC